ENOX2

Ensembl ID:
ENSDARG00000078942
Description:
ecto-NOX disulfide-thiol exchanger 2 [Source:HGNC Symbol;Acc:2259]
Human Orthologue:
ENOX2
Human Description:
ecto-NOX disulfide-thiol exchanger 2 [Source:HGNC Symbol;Acc:2259]
Mouse Orthologue:
Enox2
Mouse Description:
ecto-NOX disulfide-thiol exchanger 2 Gene [Source:MGI Symbol;Acc:MGI:2384799]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45515 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22470 Nonsense Available for shipment Available now
sa16714 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45515
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084664 Essential Splice Site 100 680 3 15
Genomic Location (Zv9):
Chromosome 14 (position 24351842)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23051632
GRCz11 14 23348877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCTCGGAATGGCCCCCATGAGCATGACTGGCCAACCTATCATGTCAGG[T/A]AAGCTATGAGTTATATGAGCTATAAGAACTTTTATTATGTTTTTTTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22470
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084664 Nonsense 494 680 10 15
Genomic Location (Zv9):
Chromosome 14 (position 24447357)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23147147
GRCz11 14 23444392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGTAAAGCGCAGCCCCAGCGCAGCGAGGAGGATGCCACCCGCCAGCAG[C/T]AGCTCAGCTTCCTGCAGCAGGCTCTGCAGGGCATGCAGAAGGTATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084664 Essential Splice Site 638 680 15 15
Genomic Location (Zv9):
Chromosome 14 (position 24481764)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23181554
GRCz11 14 23478799
KASP Assay ID:
2260-7512.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATATGAAAGGAGTTGRAGTGTTTTAATCATCATTTTTCTTGTTGTTTC[A/T]GATCAGTACCACAGAAGTGGAGAGTCTTTTGGGTCGYCTGCCCTGCACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link