Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bat5l
- Ensembl ID:
- ENSDARG00000078929
- ZFIN ID:
- ZDB-GENE-060307-3
- Description:
- protein BAT5 [Source:RefSeq peptide;Acc:NP_001104648]
- Human Orthologues:
- BAT5, C20orf135
- Human Descriptions:
- chromosome 20 open reading frame 135 [Source:HGNC Symbol;Acc:16128]
- HLA-B associated transcript 5 [Source:HGNC Symbol;Acc:13921]
- Mouse Orthologues:
- Bat5, BC050777
- Mouse Descriptions:
- cDNA sequence BC050777 Gene [Source:MGI Symbol;Acc:MGI:3607711]
- HLA-B associated transcript 5 Gene [Source:MGI Symbol;Acc:MGI:99476]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa15277 | Nonsense | Available for shipment | Available now |
| sa6412 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15277
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000110606 | Nonsense | 102 | 543 | 4 | 20 |
| ENSDART00000125621 | Nonsense | 115 | 557 | 5 | 22 |
- Genomic Location (Zv9):
- Chromosome 16 (position 12115786)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 10615452 GRCz11 16 10506354 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGAGTCAGTATGTWGGAACAGCGCTGGTCTGTCTGCTYGGAGTGGCCTG[T/A]CTGAGAGGTGATGCTATATTTACNTTTTTTTATTACCAATGTTTGTCTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6412
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000110606 | Nonsense | 330 | 543 | 12 | 20 |
| ENSDART00000125621 | Nonsense | 343 | 557 | 13 | 22 |
- Genomic Location (Zv9):
- Chromosome 16 (position 12098796)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 10598462 GRCz11 16 10489364 - KASP Assay ID:
- 554-4179.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCAAYGCGATGGACGTGGTCATTCAGTTTGCTGTGCACAAACTGGGCTTC[C/T]AGTTGAGTGACATCATAGTTTATGCCTGGTCGATAGGGGGATTCACAGGT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Systolic blood pressure: Genetic variants in novel pathways influence blood pressure and cardiovascular disease risk. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
