si:dkey-3p8.7

Ensembl ID:
ENSDARG00000078924
ZFIN ID:
ZDB-GENE-041008-216
Human Orthologue:
TMCO4
Human Description:
transmembrane and coiled-coil domains 4 [Source:HGNC Symbol;Acc:27393]
Mouse Orthologue:
Tmco4
Mouse Description:
transmembrane and coiled-coil domains 4 Gene [Source:MGI Symbol;Acc:MGI:1924306]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37774 Nonsense Mutation detected in F1 DNA During 2018
sa15728 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113893 Nonsense 360 688 10 14
ENSDART00000134589 Nonsense 340 668 9 13

The following transcripts of ENSDARG00000078924 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 39860317)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39821882
GRCz11 23 39714793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCCATCCTCAGGGATAGTGACCGCTCTGACATGGCCTGCATCTCTGT[T/A]AGCTGTGGCCAGTGTGATCGACAACCCTTGGGGAGTTTGCTTGAGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113893 Nonsense 587 688 14 14
ENSDART00000134589 Nonsense 567 668 13 13

The following transcripts of ENSDARG00000078924 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 39872563)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39834128
GRCz11 23 39727039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGWAAATGCTGATGAAAACCAAAAGCAGAGCGAAGTGCGGTGCGAGAGG[C/T]AGGACTCTGAGAATGGCWGGGATATTCCTGATATATCCGATTTACTCGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link