
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:195245
- Ensembl ID:
- ENSDARG00000078917
- ZFIN ID:
- ZDB-GENE-081022-200
- Description:
- hypothetical protein LOC565483 [Source:RefSeq peptide;Acc:NP_001119894]
- Human Orthologue:
- FAM107A
- Human Description:
- family with sequence similarity 107, member A [Source:HGNC Symbol;Acc:30827]
- Mouse Orthologue:
- Fam107a
- Mouse Description:
- family with sequence similarity 107, member A Gene [Source:MGI Symbol;Acc:MGI:3041256]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13586 | Essential Splice Site | Available for shipment | Available now |
sa45322 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa13586
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112611 | Essential Splice Site | 47 | 187 | 1 | 5 |
ENSDART00000145179 | Essential Splice Site | 16 | 145 | 1 | 5 |
ENSDART00000145894 | Essential Splice Site | 16 | 156 | 1 | 5 |
- Genomic Location (Zv9):
- Chromosome 8 (position 24633213)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 23759031 GRCz11 8 23780270 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAATGCTGGACCTGAGCACRACGAAGAAACAATCATCTGTGTGCATTGAG[G/A]TGAGTGTTATTATGATTAGAGAATGATCGTGTACTTAAAACATTAGTGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45322
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112611 | Nonsense | 170 | 187 | 5 | 5 |
ENSDART00000145179 | None | 145 | 5 | 5 | |
ENSDART00000145894 | Nonsense | 139 | 156 | 5 | 5 |
- Genomic Location (Zv9):
- Chromosome 8 (position 24629942)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 23755760 GRCz11 8 23776999 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTATGAGATGGAGGAACAGAGGCGTCTTGAGGATGAGAAAAATGTCCCA[G/T]AATTTGTACGAGTGAAAGAGAATCTGCGCCGCATACAGTTGGCCGAAAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: