zgc:195245

Ensembl ID:
ENSDARG00000078917
ZFIN ID:
ZDB-GENE-081022-200
Description:
hypothetical protein LOC565483 [Source:RefSeq peptide;Acc:NP_001119894]
Human Orthologue:
FAM107A
Human Description:
family with sequence similarity 107, member A [Source:HGNC Symbol;Acc:30827]
Mouse Orthologue:
Fam107a
Mouse Description:
family with sequence similarity 107, member A Gene [Source:MGI Symbol;Acc:MGI:3041256]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13586 Essential Splice Site Available for shipment Available now
sa45322 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112611 Essential Splice Site 47 187 1 5
ENSDART00000145179 Essential Splice Site 16 145 1 5
ENSDART00000145894 Essential Splice Site 16 156 1 5
Genomic Location (Zv9):
Chromosome 8 (position 24633213)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23759031
GRCz11 8 23780270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGCTGGACCTGAGCACRACGAAGAAACAATCATCTGTGTGCATTGAG[G/A]TGAGTGTTATTATGATTAGAGAATGATCGTGTACTTAAAACATTAGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112611 Nonsense 170 187 5 5
ENSDART00000145179   None 145 5 5
ENSDART00000145894 Nonsense 139 156 5 5
Genomic Location (Zv9):
Chromosome 8 (position 24629942)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23755760
GRCz11 8 23776999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATGAGATGGAGGAACAGAGGCGTCTTGAGGATGAGAAAAATGTCCCA[G/T]AATTTGTACGAGTGAAAGAGAATCTGCGCCGCATACAGTTGGCCGAAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link