zgc:163098

Ensembl ID:
ENSDARG00000078911
ZFIN IDs:
ZDB-GENE-070410-141, ZDB-GENE-070410-141
Description:
U2-associated SR140 protein-like [Source:RefSeq peptide;Acc:NP_001083001]
Human Orthologue:
AC018450.1
Human Description:
U2-associated protein SR140 [Source:UniProtKB/Swiss-Prot;Acc:O15042]
Mouse Orthologue:
2610101N10Rik
Mouse Description:
RIKEN cDNA 2610101N10 gene Gene [Source:MGI Symbol;Acc:MGI:1915208]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6993 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6994 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40504 Nonsense Mutation detected in F1 DNA During 2018
sa38490 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40505 Nonsense Mutation detected in F1 DNA During 2018
sa33656 Nonsense Mutation detected in F1 DNA During 2018
sa33657 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113642 Essential Splice Site 100 874 3 23
ENSDART00000114671 Essential Splice Site 100 367 3 11
ENSDART00000122919 Essential Splice Site 118 942 5 28
Genomic Location (Zv9):
Chromosome 5 (position 38894022)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36693706
GRCz11 5 37293859
KASP Assay ID:
554-4763.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYCCACYTCAGAATACCTCACCTGTTCACCATRCAGAAGTTAAAAAAGCT[G/T]WAAGTGAGCTTCTRTCTACTATAGTYAGATGAGGTTAATATCCTCAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113642 Essential Splice Site 100 874 3 23
ENSDART00000114671 Essential Splice Site 100 367 3 11
ENSDART00000122919 Essential Splice Site 118 942 5 28
Genomic Location (Zv9):
Chromosome 5 (position 38894023)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36693707
GRCz11 5 37293860
KASP Assay ID:
554-4481.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCCACYTCAGAATACCTCACCTGTTCACCATRCAGAAGTTAAAAAAGCTK[T/A]AAGTGAGCTTCTRTCTACTATAGTYAGATGAGGTTAATATCCTCAGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113642 Nonsense 144 874 5 23
ENSDART00000114671 Nonsense 144 367 5 11
ENSDART00000122919 Nonsense 162 942 7 28
Genomic Location (Zv9):
Chromosome 5 (position 38895652)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36695336
GRCz11 5 37295489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAGGAGCGATACAAAAGGAAGAAAGGCGACTCTGGAGCAGTTTTTT[T/A]AGGAGATCTAGAACCTCTGACACGAAGATCAAGTAAGTTTGGCAAACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113642 Essential Splice Site 231 874 7 23
ENSDART00000114671 Essential Splice Site 231 367 7 11
ENSDART00000122919 Essential Splice Site 252 942 9 28
Genomic Location (Zv9):
Chromosome 5 (position 38896194)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36695878
GRCz11 5 37296031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTTATGACACGGAAAGATGCAGAACGTGCTCTGGCAGCGCTGGACG[G/A]TGAGATCGTCAATGTGAATGTGAAAATTGCATTGTTGGCTAGTTACGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113642 Nonsense 419 874 12 23
ENSDART00000114671   None 367 None 11
ENSDART00000122919 Nonsense 440 942 14 28
Genomic Location (Zv9):
Chromosome 5 (position 38901515)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36701199
GRCz11 5 37301352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACGGCGATGAAGAACCAGAGGAAGCATCATTCCCTTCTCCAGAGGAA[G/T]AGCCAAAGAAAGGGCAACTGAAGTCAGAGTAAGCATACATTTGGCAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113642 Nonsense 494 874 14 23
ENSDART00000114671   None 367 None 11
ENSDART00000122919 Nonsense 515 942 16 28
Genomic Location (Zv9):
Chromosome 5 (position 38901973)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36701657
GRCz11 5 37301810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGAATATTGCAGATCGCCCGACTTTACCTGATATCCGACATCCTCTA[C/A]AATTCCTGTGCCAAAGTTGCTAATGCATCATATTACCGTAAATTGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113642 Essential Splice Site 684 874 19 23
ENSDART00000114671   None 367 None 11
ENSDART00000122919 Essential Splice Site 709 942 21 28
Genomic Location (Zv9):
Chromosome 5 (position 38907508)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36707192
GRCz11 5 37307345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTCATCCTTTCAGCCAAGAATGACTCAGACAATGAGGTGAATTCAGG[G/T]TAAGACCATTATTCATTGTTCACTATGATAAGTGGATGATTCAGGTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link