si:dkey-8f21.3

Ensembl ID:
ENSDARG00000078908
ZFIN ID:
ZDB-GENE-090313-350
Description:
Novel protein similar to H.sapiens FBXO41, F-box protein 41 (FBXO41) [Source:UniProtKB/TrEMBL;Acc:B8
Human Orthologue:
FBXO41
Human Description:
F-box protein 41 [Source:HGNC Symbol;Acc:29409]
Mouse Orthologue:
Fbxo41
Mouse Description:
F-box protein 41 Gene [Source:MGI Symbol;Acc:MGI:1261912]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19548 Nonsense Available for shipment Available now
sa39662 Nonsense Mutation detected in F1 DNA During 2018
sa31221 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113650 Nonsense 169 805 1 12
ENSDART00000140945   None 323 None 8
ENSDART00000145789 Nonsense 169 387 2 5
Genomic Location (Zv9):
Chromosome 1 (position 42073427)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40989743
GRCz11 1 41690907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGACGAGAGGCTGGAGAAGCTGTCAGAAGAGGTGGAGCAAAAGATTT[C/A]AGCAAGAGTCAGTCGTCTGCAGGCCGAGTTGGAGAGGAAAAGCTCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113650 Nonsense 239 805 1 12
ENSDART00000140945   None 323 None 8
ENSDART00000145789 Nonsense 239 387 2 5
Genomic Location (Zv9):
Chromosome 1 (position 42073636)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 40989952
GRCz11 1 41691116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCCTTAAGCAGGATCTGGTTAACAAAGAGCAGGAGCTTTCACACAAA[C/T]AACAGTGAGTTCTTTTTTTCATGATAAACCTCCTACACCTAAATGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113650 Nonsense 617 805 7 12
ENSDART00000140945 Nonsense 135 323 3 8
ENSDART00000145789   None 387 None 5
Genomic Location (Zv9):
Chromosome 1 (position 42130001)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 41046317
GRCz11 1 41747481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGACAGATCGCTCTCTGTGGTTGGCCAGCTGTTACTGCAGGGCACTA[C/T]AAGCTGTCACATACAGGTGAGTCCCTGTGTGCTTTTATCACTCTATGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link