
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
brd4
- Ensembl ID:
- ENSDARG00000078904
- ZFIN IDs:
- ZDB-GENE-030131-267, ZDB-GENE-030131-267
- Description:
- bromodomain-containing protein 4 [Source:RefSeq peptide;Acc:NP_001104751]
- Human Orthologue:
- BRD4
- Human Description:
- bromodomain containing 4 [Source:HGNC Symbol;Acc:13575]
- Mouse Orthologue:
- Brd4
- Mouse Description:
- bromodomain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1888520]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa8905 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa855 | Nonsense | F2 line generated | During 2018 |
sa33315 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8905
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114343 | Nonsense | 201 | 1444 | 4 | 21 |
ENSDART00000115117 | Nonsense | 201 | 1444 | 6 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 53836543)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 52943858 GRCz11 3 53198521 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGACTGCAAGCCCTCAAACACGTGGCCTTTCTAATCTTACCCCAGGGCCA[C/T]AAACTAGAGGACCACCACAGGGTCCACCTACTTTACCTCCCCAGCCTATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa855
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114343 | Nonsense | 880 | 1444 | 11 | 21 |
ENSDART00000115117 | Nonsense | 880 | 1444 | 13 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 53844558)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 52951873 GRCz11 3 53206536 - KASP Assay ID:
- 554-0758.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGCTCCACCTCACCTCAACGCTCACCCTCCAGGAGGCCCAGTGTCACCT[G/T]AGACGCATCCGTTCCTCAACCAGCACCCCATCCTTCCATCCCCAGGTGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33315
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114343 | Nonsense | 1072 | 1444 | 12 | 21 |
ENSDART00000115117 | Nonsense | 1072 | 1444 | 14 | 20 |
- Genomic Location (Zv9):
- Chromosome 3 (position 53849562)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 52956877 GRCz11 3 53211540 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCAGACTCAAGTGCAGCCGCAGCAGCCAGCGCCACACCAGCCCTCGCCA[C/T]AGCTCTCACAGCACCAGGCCAGACACATGCAGCAGCTCGGCTTCCCTCAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: