hemk1

Ensembl ID:
ENSDARG00000078894
ZFIN ID:
ZDB-GENE-050208-185
Description:
hemK methyltransferase family member 1 [Source:RefSeq peptide;Acc:NP_001107891]
Human Orthologue:
HEMK1
Human Description:
HemK methyltransferase family member 1 [Source:HGNC Symbol;Acc:24923]
Mouse Orthologue:
Hemk1
Mouse Description:
HemK methyltransferase family member 1 Gene [Source:MGI Symbol;Acc:MGI:1916786]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33934 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45264 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113157 Essential Splice Site 23 342 1 11
Genomic Location (Zv9):
Chromosome 6 (position 41466976)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41538576
GRCz11 6 41536112
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTCTTCGCCGATGTATGCACAGAAAGAGTGGATTGTTAAAACAGAGG[G/A]TAAATGTTTGATTGATCTCCTATGCATTTTAATAACGATCACTCTCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113157 Essential Splice Site 116 342 3 11
Genomic Location (Zv9):
Chromosome 6 (position 41463381)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 41534981
GRCz11 6 41532517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAAGAAAGAGAAACTGTGTGGAAATTGTGCTCAAAACGCCTAACAAG[G/A]TACTACAGCGTTTCGCTTTCTATGATTTTCACAGATAATTAAGATTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link