
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hemk1
- Ensembl ID:
- ENSDARG00000078894
- ZFIN ID:
- ZDB-GENE-050208-185
- Description:
- hemK methyltransferase family member 1 [Source:RefSeq peptide;Acc:NP_001107891]
- Human Orthologue:
- HEMK1
- Human Description:
- HemK methyltransferase family member 1 [Source:HGNC Symbol;Acc:24923]
- Mouse Orthologue:
- Hemk1
- Mouse Description:
- HemK methyltransferase family member 1 Gene [Source:MGI Symbol;Acc:MGI:1916786]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33934 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa45264 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33934
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113157 | Essential Splice Site | 23 | 342 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 6 (position 41466976)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 41538576 GRCz11 6 41536112 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTTTCTTCGCCGATGTATGCACAGAAAGAGTGGATTGTTAAAACAGAGG[G/A]TAAATGTTTGATTGATCTCCTATGCATTTTAATAACGATCACTCTCTAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45264
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113157 | Essential Splice Site | 116 | 342 | 3 | 11 |
- Genomic Location (Zv9):
- Chromosome 6 (position 41463381)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 41534981 GRCz11 6 41532517 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACAAAGAAAGAGAAACTGTGTGGAAATTGTGCTCAAAACGCCTAACAAG[G/A]TACTACAGCGTTTCGCTTTCTATGATTTTCACAGATAATTAAGATTTTGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: