wu:fj21g01

Ensembl ID:
ENSDARG00000078872
ZFIN ID:
ZDB-GENE-030131-7496
Human Orthologue:
TRAK2
Human Description:
trafficking protein, kinesin binding 2 [Source:HGNC Symbol;Acc:13206]
Mouse Orthologue:
Trak2
Mouse Description:
trafficking protein, kinesin binding 2 Gene [Source:MGI Symbol;Acc:MGI:1918077]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9096 Nonsense Mutation detected in F1 DNA During 2018
sa20616 Essential Splice Site Available for shipment Available now
sa20615 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112204 Nonsense 38 974 2 15
Genomic Location (Zv9):
Chromosome 6 (position 4087112)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4055777
GRCz11 6 4216597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAAGGTGTGTGACGGGGGTGTCAGCGGGTGTGGAGAGGATTYGCTGTA[T/A]CTTTACGAGGGTCAAGATTGGGTCATTTCTCCATCCTGCTCTCCAGACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112204 Essential Splice Site 206 974 5 15
Genomic Location (Zv9):
Chromosome 6 (position 4073805)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4042483
GRCz11 6 4203303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAAACTGCAGGATCTGGAGGAGGAGAACCTCACCCTCAGATCAGAGG[T/C]GCGCCACTGACTCCTCAGCGAGTATATGTAAGGGATAAAGTACATCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112204 Nonsense 389 974 11 15
Genomic Location (Zv9):
Chromosome 6 (position 4062505)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 4031183
GRCz11 6 4192003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGAAGGTCGTCCCAGAAGCGTGTGTTCCAGACTGTGCGCTCCGTCAAT[C/T]AGTCAGTGATGAGAGCAGCCGCTGCAGGCCCTCCTATACCCGGCAGCGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link