zgc:194314

Ensembl ID:
ENSDARG00000078859
ZFIN ID:
ZDB-GENE-081022-103
Description:
hypothetical protein LOC568476 [Source:RefSeq peptide;Acc:NP_001122215]
Human Orthologue:
G0S2
Human Description:
G0/G1switch 2 [Source:HGNC Symbol;Acc:30229]
Mouse Orthologue:
G0s2
Mouse Description:
G0/G1 switch gene 2 Gene [Source:MGI Symbol;Acc:MGI:1316737]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3222 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa3222
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109464 Nonsense 8 162 1 2
Genomic Location (Zv9):
Chromosome 23 (position 39751702)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 39713267
GRCz11 23 39606178
KASP Assay ID:
554-2849.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCTGCTTTCCAGCCTCATTAATATKCATGAGGTGTGGGCGGAGTCAG[A/T]AGATCGCCAGCTTTAAAAAMGCAGAGTCTGAATRTTCGACACCCACAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link