zgc:171831

Ensembl ID:
ENSDARG00000078856
ZFIN ID:
ZDB-GENE-030131-3564
Description:
hypothetical protein LOC555979 [Source:RefSeq peptide;Acc:NP_001106807]
Human Orthologue:
SLC22A23
Human Description:
solute carrier family 22, member 23 [Source:HGNC Symbol;Acc:21106]
Mouse Orthologue:
Slc22a23
Mouse Description:
solute carrier family 22, member 23 Gene [Source:MGI Symbol;Acc:MGI:1920352]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19649 Essential Splice Site Available for shipment Available now
sa39743 Nonsense Mutation detected in F1 DNA During 2018
sa25733 Nonsense Mutation detected in F1 DNA During 2018
sa10878 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126566 Essential Splice Site 134 942 1 10
Genomic Location (Zv9):
Chromosome 2 (position 1897279)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1752365
GRCz11 2 2095171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCCAGCTATAAACTGCAAAACGGATTAGAGCAAAATATTGTCACCAAG[G/A]TAAGTGGAGTCATCCCTGAGCTACAATGTTAGGTGGCATAGGCTAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126566 Nonsense 301 942 5 10
Genomic Location (Zv9):
Chromosome 2 (position 1847864)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1702950
GRCz11 2 2045756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGCTGCTGGCGACTCAACAGTACAGTCGATCCAAATGGATCATGGAG[C/T]GAATCTCCAAGAAAAACAACATAAACCTGCAGGAGGACGCGGAGGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126566 Nonsense 623 942 10 10
Genomic Location (Zv9):
Chromosome 2 (position 1828519)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1683605
GRCz11 2 2026411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCGATATACACATGCTTATAGACGCCCCCATCCAGCAAGAACCGGCT[C/T]AGGTGCAACTGCTAAGCATGGAGACTTTGACTTCATCCCAAGGGCAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126566 Nonsense 874 942 10 10
Genomic Location (Zv9):
Chromosome 2 (position 1827766)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1682852
GRCz11 2 2025658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACCCATAGATTCTGGCACCCCATTGTTACAGTTAGACGCTCCWCCT[G/T]AGCTGAACTCTATTGAATCTGCTCCACCTTCATTAAGTAATGGTAGTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link