
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sc:d0139
- Ensembl ID:
- ENSDARG00000078824
- ZFIN ID:
- ZDB-GENE-080226-7
- Description:
- hypothetical protein LOC100141487 [Source:RefSeq peptide;Acc:NP_001108576]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9060 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa38408 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa9060
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108686 | Nonsense | 25 | 317 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 3 (position 46483196)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 48492749 GRCz11 3 46445083 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTCTGTGTTAAATCAATTCTTCTTATTGTGTTTAACAGGTACACTTGCT[A/T]AATGTCCTCTTCAGATCACCCCACAGAGTGTTGTTGTGAAGTATGGKGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38408
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108686 | Nonsense | 94 | 317 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 3 (position 46483405)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 48492958 GRCz11 3 46445292 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGAGCTGACAGACTGGGAGATACAGCCACCATTCTGCTACATAAATTA[T/A]GGCAAACAGTGTGAAGTAGCTCTCCCAGTCACTGTTTACAGTGAGTTTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: