
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
A4QP83_DANRE
- Ensembl ID:
- ENSDARG00000078814
- Description:
- LOC100005466 protein [Source:UniProtKB/TrEMBL;Acc:A4QP83]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2300 | Nonsense | F2 line generated | During 2018 |
sa20657 | Essential Splice Site | Available for shipment | Available now |
sa20656 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa2300
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108656 | Nonsense | 192 | 619 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 6 (position 10619703)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 10473329 GRCz11 6 10708756 - KASP Assay ID:
- 554-2758.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCCAGGTGCCTAGTTCTAGCTCAAGCGAGMCCTCAAAAAAGGCAGYTGAA[C/T]AGAGTCCACCACCAAAGCCCCACACACCTGCGTCCGAGCCCGATCCATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20657
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108656 | Essential Splice Site | 251 | 619 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 6 (position 10617083)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 10470709 GRCz11 6 10706136 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTCTATTGGTGAATTGTCCTTTATTACCTTAACAATGAACTTTTTCTCC[A/T]GCTGCCTAGTTCTAGCTCAGGCGAGACCTCAAAAAAGGCAGTTGAACAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20656
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108656 | Nonsense | 443 | 619 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 6 (position 10613012)
- KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCATCAGACCATAAGCAACACATGATGACCCACACCGGAGAGAAACCATA[T/G]AAATGCAATGTGTGCGACAAAGCATTTGCGTCCGCTTCAAACCTGAAGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: