slc26a10

Ensembl ID:
ENSDARG00000078800
ZFIN ID:
ZDB-GENE-030131-9845
Human Orthologue:
SLC26A10
Human Description:
solute carrier family 26, member 10 [Source:HGNC Symbol;Acc:14470]
Mouse Orthologue:
Slc26a10
Mouse Description:
solute carrier family 26, member 10 Gene [Source:MGI Symbol;Acc:MGI:2143920]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8839 Nonsense Mutation detected in F1 DNA During 2018
sa24356 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111570 Nonsense 70 690 1 18
Genomic Location (Zv9):
Chromosome 23 (position 28321054)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28151621
GRCz11 23 28078162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGACTGCCCGTGTGCAGCTGGCTGCCAAAGTACAAGCTCAGAAAATG[G/A]CTCTTAGGAGATATCATAGCCGGACTGACTGTTGGAATAGTACACATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111570 Nonsense 247 690 5 18
Genomic Location (Zv9):
Chromosome 23 (position 28323238)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 28153805
GRCz11 23 28080346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCTACAGACGTTGGCTTCAGTGATGGAAAACGTGCCCCACACTAATT[T/A]GGCTGAGCTGGTGATCTCACTGCTCTGCCTGGCTGTTCTGGTGCCTGTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link