tmem70

Ensembl ID:
ENSDARG00000078773
ZFIN ID:
ZDB-GENE-070912-593
Human Orthologue:
TMEM70
Human Description:
transmembrane protein 70 [Source:HGNC Symbol;Acc:26050]
Mouse Orthologue:
Tmem70
Mouse Description:
transmembrane protein 70 Gene [Source:MGI Symbol;Acc:MGI:1915068]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32938 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109160   None 248 None 3
ENSDART00000135171 Nonsense 119 268 2 2
Genomic Location (Zv9):
Chromosome 2 (position 29966527)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30268162
GRCz11 2 30251695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGTAAAATACAACCAACCAATGACAAGTTATTGTCAGATCTCCAACT[T/A]AATTGTGCAAATCTGCTCTTTTGTTGAAGGTGTGAAGCTTTTTTCCTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link