A5D8T0_DANRE

Ensembl ID:
ENSDARG00000078772
Description:
LOC555713 protein [Source:UniProtKB/TrEMBL;Acc:A5D8T0]
Human Orthologue:
NBR1
Human Description:
neighbor of BRCA1 gene 1 [Source:HGNC Symbol;Acc:6746]
Mouse Orthologue:
Nbr1
Mouse Description:
neighbor of Brca1 gene 1 Gene [Source:MGI Symbol;Acc:MGI:108498]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40101 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112742 Nonsense 342 1020 9 21
Genomic Location (Zv9):
Chromosome 3 (position 33074578)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32805888
GRCz11 3 32937602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGCGGAGAAACGTCAGCTGAAGGCTGAGGTAAAGGAGATCAGAAAG[C/T]AGCTGAGGATGGAGAGGCGAGGCCTACAGTGGAGCACTGCTGGAGAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link