
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-1n9.7
- Ensembl ID:
- ENSDARG00000078759
- ZFIN ID:
- ZDB-GENE-090313-71
- Description:
- Novel protein similar to vertebrate DNA replication helicase 2 homolog (Yeast) (DNA2) [Source:UniPro
- Human Orthologue:
- DNA2
- Human Description:
- DNA replication helicase 2 homolog (yeast) [Source:HGNC Symbol;Acc:2939]
- Mouse Orthologue:
- Dna2
- Mouse Description:
- DNA replication helicase 2 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2443732]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42185 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa35475 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa35476 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa773 | Nonsense | Confirmed mutation in F2 line | During 2018 |
sa8393 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42185
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109798 | Essential Splice Site | 13 | 1378 | 1 | 22 |
ENSDART00000135424 | Essential Splice Site | 13 | 237 | 1 | 3 |
ENSDART00000144094 | None | 1020 | None | 20 |
- Genomic Location (Zv9):
- Chromosome 13 (position 22962251)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 22691589 GRCz11 13 22822039 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTATTCACACATGTCTACAATGATGAAGTGCAAATCCAGCCGATCATCT[G/A]TGAGTATTTAAATAAGTTCGTTTGCTGCTATATTGTTAGATGTTTTTAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35475
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109798 | Essential Splice Site | 514 | 1378 | 6 | 22 |
ENSDART00000135424 | None | 237 | None | 3 | |
ENSDART00000144094 | Essential Splice Site | 160 | 1020 | 3 | 20 |
- Genomic Location (Zv9):
- Chromosome 13 (position 22969336)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 22698674 GRCz11 13 22829124 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACATTTGCCACGGAGGCCTTAAGAAGCCCCAACTACCTCGGACAAATG[T/A]AAGTACTCTCCTGTAACTGTCAACTCCACCTTTAGTGGCAAACTTGGGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35476
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109798 | Essential Splice Site | 674 | 1378 | 9 | 22 |
ENSDART00000135424 | None | 237 | None | 3 | |
ENSDART00000144094 | Essential Splice Site | 320 | 1020 | 6 | 20 |
- Genomic Location (Zv9):
- Chromosome 13 (position 22970292)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 22699630 GRCz11 13 22830080 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGACTGGCAGTCTACATCCTGTTGTGGGCAATCACATGGACAGGAGAGG[T/C]TAGATTTATATAGAGGTTTATACTTGTAAAGGACAGAAATGAAGATTCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa773
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109798 | Nonsense | 710 | 1378 | 10 | 22 |
ENSDART00000135424 | None | 237 | None | 3 | |
ENSDART00000144094 | Nonsense | 356 | 1020 | 7 | 20 |
- Genomic Location (Zv9):
- Chromosome 13 (position 22971011)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 22700349 GRCz11 13 22830799 - KASP Assay ID:
- 554-0678.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGATGGGAAAAGTCAAATGGCCCAATTGCCTGCCATTGTATCTGACCAG[C/T]AAACTTGCAAATATTGTCCTCAGAAAAGGAACTGTGCAATTTACAACAGG
- Associated Phenotype:
-
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.
Stage Entity Entity Quality Tag Larval:Day 5
ZFS:0000037eye
ZFA:0000107decreased size
PATO:0000587abnormal
PATO:0000460Larval:Day 5
ZFS:0000037head
ZFA:0001114malformed
PATO:0000646abnormal
PATO:0000460Larval:Day 5
ZFS:0000037larval locomotory behavior
GO:0008345disrupted
PATO:0001507abnormal
PATO:0000460Larval:Day 5
ZFS:0000037swim bladder
ZFA:0000076aplastic
PATO:0001483abnormal
PATO:0000460Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094anterior/posterior axis
BSPO:0000013increased length
PATO:0000573abnormal
PATO:0000460
Mutation Details
- Allele Name:
- sa8393
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109798 | Nonsense | 931 | 1378 | 14 | 22 |
ENSDART00000135424 | None | 237 | None | 3 | |
ENSDART00000144094 | Nonsense | 577 | 1020 | 11 | 20 |
- Genomic Location (Zv9):
- Chromosome 13 (position 22972492)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 22701830 GRCz11 13 22832280 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TRGAATTCAGGCCTCCTCAGTTCATTGACAGCCTCAGCAGTGTTTTGCCA[C/T]GAGATGCCAAGGACATTGTGKCCAACATTCTGAAAGGTGCATTCATACAC
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: