si:dkeyp-81f3.3

Ensembl ID:
ENSDARG00000078745
ZFIN ID:
ZDB-GENE-070705-553
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WVZ4]
Human Orthologue:
PNPLA8
Human Description:
patatin-like phospholipase domain containing 8 [Source:HGNC Symbol;Acc:28900]
Mouse Orthologue:
Pnpla8
Mouse Description:
patatin-like phospholipase domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1914702]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15305 Nonsense Available for shipment Available now
sa33425 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108928 Nonsense 141 688 1 10
ENSDART00000134709   None 429 None 8
ENSDART00000145953   None 109 None 2

The following transcripts of ENSDARG00000078745 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 12692907)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13629534
GRCz11 4 13628383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAGGAGAATCAAYACCATCTCAAATCAAACCTCTTCCCAAAGTGAAT[A/T]AAGATCATATTATAGCAGCGCCTGTGTGCCATAAATCTAMACCTGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108928 Nonsense 673 688 10 10
ENSDART00000134709 Nonsense 414 429 8 8
ENSDART00000145953   None 109 None 2

The following transcripts of ENSDARG00000078745 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 12707161)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13643788
GRCz11 4 13642637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCCTCACGCAGGAAAAAGGTATCGTTCAGAAGCTCGCAGAATGGGTA[C/T]AACTCAAAGCTGACATGTACGACGGCCTTCCCTTTCGCTCTAAACTCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Smoking behavior: Large-scale genome-wide association study of Asian population reveals genetic factors in FRMD4A and other loci influencing smoking initiation and nicotine dependence. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link