il1rapl1b

Ensembl ID:
ENSDARG00000078740
ZFIN ID:
ZDB-GENE-090109-2
Description:
interleukin-1 receptor accessory protein-like 1-B [Source:RefSeq peptide;Acc:NP_001136054]
Human Orthologue:
IL1RAPL1
Human Description:
interleukin 1 receptor accessory protein-like 1 [Source:HGNC Symbol;Acc:5996]
Mouse Orthologue:
Il1rapl1
Mouse Description:
interleukin 1 receptor accessory protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:2687319]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31847 Essential Splice Site Available for shipment Available now
sa13388 Nonsense Available for shipment Available now
sa45441 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112871 Essential Splice Site 167 466 5 6
Genomic Location (Zv9):
Chromosome 11 (position 46439681)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 43958939
GRCz11 11 44403446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGTAGTTTGGTGATGGATAGTGTCATCGTAATTCTCCATTGTGTTTC[A/T]GAAAATAAAGATTATGATGCTTACGTGTCCTACACTAAAGTGGACCCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13388
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112871 Nonsense 429 466 6 6
Genomic Location (Zv9):
Chromosome 11 (position 46442147)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 43956473
GRCz11 11 44400980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCCAGCACACGTACTGTAACATCCCTATGAGCCTGCTGARTGGCCAG[C/T]GACCACCGGGCCAACCAGCCCATGGGCAGCAGCAGAGCCTGGAGGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112871 Nonsense 433 466 6 6
Genomic Location (Zv9):
Chromosome 11 (position 46442159)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 43956461
GRCz11 11 44400968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTACTGTAACATCCCTATGAGCCTGCTGAATGGCCAGCGACCACCGGGC[C/T]AACCAGCCCATGGGCAGCAGCAGAGCCTGGAGGAGCAGCAGGTCAACAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link