si:dkey-93n13.3

Ensembl ID:
ENSDARG00000078736
ZFIN ID:
ZDB-GENE-091118-107
Human Orthologue:
DOC2A
Human Description:
double C2-like domains, alpha [Source:HGNC Symbol;Acc:2985]
Mouse Orthologue:
Doc2a
Mouse Description:
double C2, alpha Gene [Source:MGI Symbol;Acc:MGI:109446]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19967 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113632 Essential Splice Site 223 407 6 11
ENSDART00000136912 Essential Splice Site 219 405 4 9
Genomic Location (Zv9):
Chromosome 3 (position 15167445)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15413051
GRCz11 3 15562851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGGACCAGACCAAACGTTTCTACACCTGTCTAGAACATCCACCACCTG[T/A]AAGACACTCATAAACACACGTTTAGCTTGAGCTGTTGCACTGGAGGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link