si:dkey-240a9.5

Ensembl ID:
ENSDARG00000078734
ZFIN ID:
ZDB-GENE-081104-506
Description:
Novel protein similar to vertebrate myosin IE (MYO1E) [Source:UniProtKB/TrEMBL;Acc:B0S6F2]
Human Orthologue:
MYO1F
Human Description:
myosin IF [Source:HGNC Symbol;Acc:7600]
Mouse Orthologue:
Myo1f
Mouse Description:
myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12700 Nonsense Available for shipment Available now
sa16214 Essential Splice Site Available for shipment Available now
sa34373 Nonsense Mutation detected in F1 DNA During 2018
sa14554 Nonsense Available for shipment Available now
sa21261 Essential Splice Site Available for shipment Available now
sa10240 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113183 Nonsense 91 1096 3 27
ENSDART00000148304 Nonsense 92 1095 4 28
Genomic Location (Zv9):
Chromosome 8 (position 20815316)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20245213
GRCz11 8 20277298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCAATATGAAAATCCACCACACATTTACGCTCTGACAGACAACATGTA[C/A]AGGAACATGATGATTGACAGTGAAAATCAGTGTGTCATTATCAGKTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113183 Essential Splice Site 106 1096 3 27
ENSDART00000148304 Essential Splice Site 107 1095 4 28
Genomic Location (Zv9):
Chromosome 8 (position 20815271)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20245168
GRCz11 8 20277253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTAMAGGAACATGATGATTGACAGTGAAAATCAGTGTGTCATTATCAG[G/T]TTTGTGATGCTYGTGTGATTWGCGCCAAACAYGGATTTGGTGCTCTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113183 Nonsense 611 1096 17 27
ENSDART00000148304 Nonsense 610 1095 18 28
Genomic Location (Zv9):
Chromosome 8 (position 20802083)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20231980
GRCz11 8 20264065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTCACGGCCCCAGAGCGAGACATCAAGTGGAATATCTCGGCTTAAGG[G/T]AAAATATTAGGGTACGACGTGCTGGATTTGCCTACCGTAGAATCTTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113183 Nonsense 630 1096 17 27
ENSDART00000148304 Nonsense 629 1095 18 28
Genomic Location (Zv9):
Chromosome 8 (position 20802025)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20231922
GRCz11 8 20264007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGGTACGACGTGCTGGATTTGCCTACCGTAGAMTCTTCCCAAAGTTTT[T/A]ACACAGGTGAGTAAGCTCGGAAAAAATATGWTTGGTYATAAAAATTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113183 Essential Splice Site 873 1096 22 27
ENSDART00000148304 Essential Splice Site 872 1095 23 28
Genomic Location (Zv9):
Chromosome 8 (position 20792938)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20222835
GRCz11 8 20254920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTACGAGGAGCAAACCCGAAGCAAACTCACACTGTCTTTCAGCGACAG[G/A]TGCCCATTATCCTCCATCTCTCTCTCTCTCTCTCTCTCGTACCACTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113183 Nonsense 1038 1096 26 27
ENSDART00000148304 Nonsense 1037 1095 27 28
Genomic Location (Zv9):
Chromosome 8 (position 20789145)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20219042
GRCz11 8 20251127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCCAGCGTCCTCCTCCGGCCCCCTCTAGCCGGCCCAAACCTCAGGCA[C/T]GACCACAGGGCCCACGRTGCCGAGCGCTTTATCAGTATTTTGGCCAAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link