si:dkey-273o13.1

Ensembl ID:
ENSDARG00000078722
ZFIN ID:
ZDB-GENE-060526-282
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BIB0]
Human Orthologue:
CLIP1
Human Description:
CAP-GLY domain containing linker protein 1 [Source:HGNC Symbol;Acc:10461]
Mouse Orthologue:
Clip1
Mouse Description:
CAP-GLY domain containing linker protein 1 Gene [Source:MGI Symbol;Acc:MGI:1928401]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38528 Nonsense Mutation detected in F1 DNA During 2018
sa33768 Nonsense Mutation detected in F1 DNA During 2018
sa9135 Nonsense Mutation detected in F1 DNA During 2018
sa7278 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114783 Nonsense 232 1411 4 29
ENSDART00000145122   None 436 None 13
Genomic Location (Zv9):
Chromosome 5 (position 70232747)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66558857
GRCz11 5 67237226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGTTTCTTAGGGGAAACTGATTTTGCCAAGGGTGAGTGGTGTGGAGTT[G/T]AGCTGGATGAGCCCTTGGGGAAGAACGATGGAGCTGTGGCTGGAACCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114783 Nonsense 1112 1411 21 29
ENSDART00000145122 Nonsense 82 436 4 13
Genomic Location (Zv9):
Chromosome 5 (position 70196661)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66522819
GRCz11 5 67201188
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCAGCTGGATGCTCTAAAACAGCAGAACTCTCAGTATCAGGAGAGTT[T/A]GAGTTCTGACAGTGAGAGAATTAACAGCCTCAGTAAAGAGATGTGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114783 Nonsense 1129 1411 22 29
ENSDART00000145122 Nonsense 99 436 5 13
Genomic Location (Zv9):
Chromosome 5 (position 70195769)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66521927
GRCz11 5 67200296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGAANNNNNNTCTGTGTTCAAACAAATGWYGGTTATGCGTTTCAGTGAGGAGT[T/A]GAAACAAGCCGCTGTCGAGAAATCCCAGGCAGTGGACGATCTGAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114783 Essential Splice Site 1226 1411 24 29
ENSDART00000145122   None 436 None 13
Genomic Location (Zv9):
Chromosome 5 (position 70189947)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66516105
GRCz11 5 67194474
KASP Assay ID:
554-4521.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAGAAAAGGACAAAGAGCTAGACTCYATGAGAAACGAGGTAACAGTC[G/A]CTTTGGGTTTTTTGAGTGTGYGAGTGCACGTTACTGTTTTTTGCTCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link