zgc:172265

Ensembl ID:
ENSDARG00000078717
ZFIN ID:
ZDB-GENE-080220-48
Description:
hypothetical protein LOC100141346 [Source:RefSeq peptide;Acc:NP_001108383]
Human Orthologue:
ITGA8
Human Description:
integrin, alpha 8 [Source:HGNC Symbol;Acc:6144]
Mouse Orthologue:
Itga8
Mouse Description:
integrin alpha 8 Gene [Source:MGI Symbol;Acc:MGI:109442]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9052 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa17254 Splice Site, Nonsense Available for shipment Available now
sa6436 Nonsense Mutation detected in F1 DNA During 2018
sa2856 Essential Splice Site F2 line generated During 2018
sa42737 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22861 Nonsense Available for shipment Available now
sa14004 Nonsense Available for shipment Available now
sa15736 Nonsense Available for shipment Available now
sa22862 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Splice Site, Nonsense 297 1059 9 30
ENSDART00000059044 Splice Site, Nonsense 286 397 9 13
ENSDART00000141061 Splice Site, Nonsense 297 517 9 15
ENSDART00000059038 Splice Site, Nonsense 297 1059 9 30
ENSDART00000059044 Splice Site, Nonsense 286 397 9 13
ENSDART00000141061 Splice Site, Nonsense 297 517 9 15
Genomic Location (Zv9):
Chromosome 16 (position 30639409)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28476547
GRCz11 16 28411170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCAGAATTRGTAGCAGGGGTTCCTCGAGGGGCACACAACTTTGGYTA[T/A]GTAAGTATACAGACYTTGTTTCCTGTGTTTTTGTTGTGYTAAGATCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Splice Site, Nonsense 297 1059 9 30
ENSDART00000059044 Splice Site, Nonsense 286 397 9 13
ENSDART00000141061 Splice Site, Nonsense 297 517 9 15
ENSDART00000059038 Splice Site, Nonsense 297 1059 9 30
ENSDART00000059044 Splice Site, Nonsense 286 397 9 13
ENSDART00000141061 Splice Site, Nonsense 297 517 9 15
Genomic Location (Zv9):
Chromosome 16 (position 30639409)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28476547
GRCz11 16 28411170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCAGAATTRGTAGCAGGGGTTCCTCGAGGGGCACACAACTTTGGYTA[T/A]GTAAGTATACAGACYTTGTTTCCTGTGTTTTTGTTGTGYTAAGATCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Nonsense 363 1059 12 30
ENSDART00000059044 Nonsense 352 397 12 13
ENSDART00000141061 Nonsense 363 517 12 15
Genomic Location (Zv9):
Chromosome 16 (position 30648369)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28485507
GRCz11 16 28420130
KASP Assay ID:
554-4434.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCGCGAGTTTGAGAGTAAGCCTCGAGAGGTGGGCCGGGTTTAYTTATA[T/A]CTGCAAGAAGATGTGCTTCTCTTCTCTYCTCCCATCACACTCACTGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2856
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Essential Splice Site 482 1059 14 30
ENSDART00000059044   None 397 None 13
ENSDART00000141061 Essential Splice Site 482 517 14 15
Genomic Location (Zv9):
Chromosome 16 (position 30674074)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28511212
GRCz11 16 28445835
KASP Assay ID:
554-3020.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATTTGCTGGTCGGTGCATTTGGAGTGAGTAAAGTYGTGGCCTACAGG[T/A]GAGAAATTTTACACCTTGAATTCACTAGAAAGTTGACAMTGNYTTTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Essential Splice Site 589 1059 18 30
ENSDART00000059044   None 397 None 13
ENSDART00000141061   None 517 None 15
Genomic Location (Zv9):
Chromosome 16 (position 30688556)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28525694
GRCz11 16 28460317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGATCTTTTTCTCTCTGTTGTTGTTTCATCCTGCTCTGTTTGTGTGT[A/C]GGATGAGGCCGAGTTCAGGGATAAACTGAGTCCTATCAGCGTGACACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Nonsense 669 1059 20 30
ENSDART00000059044   None 397 None 13
ENSDART00000141061   None 517 None 15
Genomic Location (Zv9):
Chromosome 16 (position 30691770)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28528908
GRCz11 16 28463531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTTTCTGTATAGGGACCGGACTGAGCTTATAATCGGGGATGACAACT[T/A]GCTGATGTTGACTATTAATGCAGCCAATGAGGGTGAGGGGGCGTATGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14004
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Nonsense 904 1059 26 30
ENSDART00000059044   None 397 None 13
ENSDART00000141061   None 517 None 15
Genomic Location (Zv9):
Chromosome 16 (position 30726109)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28563247
GRCz11 16 28497870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGTTACTGGGCTTCCTGAGGAACAGCAGCGGAGTGACCCGCCGAAGA[C/T]GATCTGTTTCTATAGGCCAAAGCTACARYAGCAAAACACTGGTACAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Nonsense 979 1059 28 30
ENSDART00000059044   None 397 None 13
ENSDART00000141061   None 517 None 15
Genomic Location (Zv9):
Chromosome 16 (position 30732696)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28569834
GRCz11 16 28504457
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTAAACTCCACAGTGTCCTTTCAAGTGACRGCCATGCCTTATCGCATC[A/T]AAGCTGAGASACTCCCACGCCAGAGCAAATCAGTGAGTAATACAATTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059038 Essential Splice Site 1030 1059 29 30
ENSDART00000059044   None 397 None 13
ENSDART00000141061   None 517 None 15
Genomic Location (Zv9):
Chromosome 16 (position 30735530)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28572668
GRCz11 16 28507291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGCTGGGACTGCTGGTGCTGGCAGTGCTTAGCCTAGCAATGTGGAAG[G/A]TAGGTCATAAAAAAGACTGAAAATACATGTTTATGATACTGTTGGTTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link