
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sema7a
- Ensembl ID:
- ENSDARG00000078707
- ZFIN ID:
- ZDB-GENE-030131-3633
- Description:
- semaphorin-7A [Source:RefSeq peptide;Acc:NP_001108357]
- Human Orthologue:
- SEMA7A
- Human Description:
- semaphorin 7A, GPI membrane anchor (John Milton Hagen blood group) [Source:HGNC Symbol;Acc:10741]
- Mouse Orthologue:
- Sema7a
- Mouse Description:
- sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A Gene [Source:MGI S
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38090 | Nonsense | Available for shipment | Available now |
sa24691 | Nonsense | Available for shipment | Available now |
sa44317 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38090
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127274 | Nonsense | 126 | 640 | 4 | 14 |
- Genomic Location (Zv9):
- Chromosome 25 (position 27712218)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 26402312 GRCz11 25 26845514 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACTTTTCAAAACTGCAAATTTGTATGTGGGACAAATGGAGAAGAGCCA[C/T]AGTGCTGGGAACTGGTAAGAGAACTTATTAGTAGTGCAATATTTTTGGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24691
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127274 | Nonsense | 212 | 640 | 7 | 14 |
- Genomic Location (Zv9):
- Chromosome 25 (position 27713517)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 26403611 GRCz11 25 26846813 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTCTCCCACACAGAACCTACTTTTATCTCCAGTTTCCTGGCCAAGCGC[A/T]AAAATGACTCCTTGAATGAGAAGATATATGTCCTATTCCGAGAAAAAAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44317
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127274 | Nonsense | 569 | 640 | 14 | 14 |
- Genomic Location (Zv9):
- Chromosome 25 (position 27733218)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 26423312 GRCz11 25 26866514 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCATGCCAGTTATAGATGGGAACACGGGGGCAAAAGCAACCCATGTCAA[C/T]AGACCCAATCGGAATACCTCCTCCTAATCCCAGCTATGACGGCTGAGAAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Airflow obstruction : Genome-wide association studies identify CHRNA5/3 and HTR4 in the development of airflow obstruction. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: