vcana

Ensembl ID:
ENSDARG00000078680
ZFIN ID:
ZDB-GENE-011023-1
Description:
Novel protein similar to vertebrate chondroitin sulfate proteoglycan 2 (Versican) (CSPG2) [Source:Un
Human Orthologue:
VCAN
Human Description:
versican [Source:HGNC Symbol;Acc:2464]
Mouse Orthologue:
Vcan
Mouse Description:
versican Gene [Source:MGI Symbol;Acc:MGI:102889]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1460 Nonsense Available for shipment Available now
sa1563 Essential Splice Site F2 line generated During 2018
sa38500 Essential Splice Site Mutation detected in F1 DNA During 2018
sa8951 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40547 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15805 Essential Splice Site Available for shipment Available now
sa40548 Nonsense Mutation detected in F1 DNA During 2018
sa17331 Essential Splice Site Available for shipment Available now
sa17829 Essential Splice Site Available for shipment Available now
sa15511 Nonsense Available for shipment Available now
sa17232 Nonsense Available for shipment Available now
sa33699 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20520 Nonsense Available for shipment Available now
sa2210 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa1460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Nonsense 230 2896 4 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48039943)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45828683
GRCz11 5 46428836
KASP Assay ID:
554-1385.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCTGTTTTGGAAACCTGCCTGGAAAACCTGGTGTTAGGTCGTATGGC[A/T]AACGGAAACCCACAGAAACTTATGATGTGTTCTGTTATGTGGATAAACTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1563
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Essential Splice Site 398 2896 9 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48057817)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45846557
GRCz11 5 46446710
KASP Assay ID:
554-1506.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATACCGTGTCAGCCAGTTTTTCTTCAAGCTTTCCATCAACAGAGTCA[G/T]CAAGTTCAAAACATGGGACCTCTGACATRTATAGCAAAGAGTTTAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Essential Splice Site 399 2896 10 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48058208)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45846948
GRCz11 5 46447101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGAATCTACTGTAACTTATGTATCAGAGACACTGTCCTCCTCTGCTC[A/T]GACAAGATATTTAGACAAGCCATTATCTGAAAGCACTGACACAGAAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Essential Splice Site 486 2896 11 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48059356)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45848096
GRCz11 5 46448249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACAGAACCTGCCTTTTCTCTTCTGAATWTATCTACCGAATTWAGCGAA[G/A]TGTATACATTAACACCATTGAATACTGGGTACTCAACAGACAAAAGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Essential Splice Site 486 2896 11 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48059357)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45848097
GRCz11 5 46448250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGAACCTGCCTTTTCTCTTCTGAATTTATCTACCGAATTTAGCGAAG[T/C]GTATACATTAACACCATTGAATACTGGGTACTCAACAGACAAAAGTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Essential Splice Site 640 2896 15 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48062030)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45850770
GRCz11 5 46450923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAMAAGCCAAGATACTGCATTAACAGAAAGAAMAGTCACAAATCAAARTA[G/A]TACACCTTTCACAGRAACAACTGCAGCAAMTRTTATGAAGGATGAAGAAK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Nonsense 780 2896 16 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48062747)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45851487
GRCz11 5 46451640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATCTCTTTTATCTACTGCATCTATGACAAAACATACATTTACATCAT[T/A]GAGCACTGGGGAATCAACAGGACAGACCGTTGCAAGCCAAGATACTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17331
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Essential Splice Site 946 2896 18 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48063813)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45852553
GRCz11 5 46452706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGATGCTGCTGTCAMAAGCACACAATCATCAGAGAAGACAACAGCCAG[A/T]GATTTTTTTKCAACTTCAACAATAGCAWCAATTTTGTCTTTTTCAGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Essential Splice Site 1821 2896 30 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48072456)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45861196
GRCz11 5 46461349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTGTTGAAGGACAMAGAGCTGTYAGCAAACCCAWCTGTATTAATCAG[T/C]ACTGATGTTTCAGAGACAATGTCCAGCTCAACAGATCMTGATGTCACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Nonsense 1940 2896 33 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48074365)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45863105
GRCz11 5 46463258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACAATGATCTCAGAGAAAACARCTCTGTCATCRTCATATTTTYCTTCT[A/T]GATTGCCATCAACAGAATCCSACTTTTCTGGGGATTACAGCTCTGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Nonsense 1966 2896 33 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48074444)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45863184
GRCz11 5 46463337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGGATTACAGCTCTGAAATGCTAAGCAAAGAGTTTACAAMAAGTCCTT[T/A]GCCRTACACTAYAACAAAATCMGGCCTAGAATTCAGTAAAACCCCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Essential Splice Site 2026 2896 35 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48075458)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45864198
GRCz11 5 46464351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACTATAACACAAAGTTCCAACACTATCACCTCTGTACTTTCAGACA[G/A]TGAGGGTTCTGGTGTTGTAGAAGATGACCGGGAAACTGCACAGTTAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Nonsense 2115 2896 36 49
ENSDART00000144973   None 157 None 3
Genomic Location (Zv9):
Chromosome 5 (position 48076010)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45864750
GRCz11 5 46464903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACCAGACGATTCTACAGGTTATGTATTCAGAACACCAACAACTAAGT[C/A]ATATGATGATCTAACTGTAAGAACAGATGAGGCAGAAGTGGATGAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2210
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099132 Essential Splice Site 2777 2896 47 49
ENSDART00000144973   1 157 1 3
Genomic Location (Zv9):
Chromosome 5 (position 48092692)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45881432
GRCz11 5 46481585
KASP Assay ID:
554-2637.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTCTACAGGGNNNNNNNNNNNNNNNNNTCACAATCCTTACCTCTATCTGTGTTCTTCCTCTACA[G/A]CAATATGAAAACTGGAGACCGAACCAGCCGGACAGTTTCTTCTCCTCCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link