vcana
- Ensembl ID:
- ENSDARG00000078680
- ZFIN ID:
- ZDB-GENE-011023-1
- Description:
- Novel protein similar to vertebrate chondroitin sulfate proteoglycan 2 (Versican) (CSPG2) [Source:Un
- Human Orthologue:
- VCAN
- Human Description:
- versican [Source:HGNC Symbol;Acc:2464]
- Mouse Orthologue:
- Vcan
- Mouse Description:
- versican Gene [Source:MGI Symbol;Acc:MGI:102889]
Alleles
There are 14 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa1460 |
Nonsense |
Available for shipment |
Available now |
sa1563 |
Essential Splice Site |
F2 line generated |
During 2018 |
sa38500 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa8951 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa40547 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa15805 |
Essential Splice Site |
Available for shipment |
Available now |
sa40548 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa17331 |
Essential Splice Site |
Available for shipment |
Available now |
sa17829 |
Essential Splice Site |
Available for shipment |
Available now |
sa15511 |
Nonsense |
Available for shipment |
Available now |
sa17232 |
Nonsense |
Available for shipment |
Available now |
sa33699 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa20520 |
Nonsense |
Available for shipment |
Available now |
sa2210 |
Essential Splice Site |
F2 line generated |
During 2018 |
Mutation Details
- Allele Name:
- sa1460
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 5 (position 48039943)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45828683 |
GRCz11 |
5 |
46428836 |
- KASP Assay ID:
- 554-1385.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTGGCTGTTTTGGAAACCTGCCTGGAAAACCTGGTGTTAGGTCGTATGGC[A/T]AACGGAAACCCACAGAAACTTATGATGTGTTCTGTTATGTGGATAAACTT
- Associated Phenotype:
Normal
Mutation Details
- Allele Name:
- sa1563
- Current Status:
-
F2 line generated
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 5 (position 48057817)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45846557 |
GRCz11 |
5 |
46446710 |
- KASP Assay ID:
- 554-1506.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAGATACCGTGTCAGCCAGTTTTTCTTCAAGCTTTCCATCAACAGAGTCA[G/T]CAAGTTCAAAACATGGGACCTCTGACATRTATAGCAAAGAGTTTAAAACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38500
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 5 (position 48058208)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45846948 |
GRCz11 |
5 |
46447101 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCTGAATCTACTGTAACTTATGTATCAGAGACACTGTCCTCCTCTGCTC[A/T]GACAAGATATTTAGACAAGCCATTATCTGAAAGCACTGACACAGAAACCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8951
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 5 (position 48059356)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45848096 |
GRCz11 |
5 |
46448249 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTACAGAACCTGCCTTTTCTCTTCTGAATWTATCTACCGAATTWAGCGAA[G/A]TGTATACATTAACACCATTGAATACTGGGTACTCAACAGACAAAAGTGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40547
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 5 (position 48059357)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45848097 |
GRCz11 |
5 |
46448250 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACAGAACCTGCCTTTTCTCTTCTGAATTTATCTACCGAATTTAGCGAAG[T/C]GTATACATTAACACCATTGAATACTGGGTACTCAACAGACAAAAGTGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15805
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 5 (position 48062030)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45850770 |
GRCz11 |
5 |
46450923 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TAMAAGCCAAGATACTGCATTAACAGAAAGAAMAGTCACAAATCAAARTA[G/A]TACACCTTTCACAGRAACAACTGCAGCAAMTRTTATGAAGGATGAAGAAK
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40548
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 5 (position 48062747)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45851487 |
GRCz11 |
5 |
46451640 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCATCTCTTTTATCTACTGCATCTATGACAAAACATACATTTACATCAT[T/A]GAGCACTGGGGAATCAACAGGACAGACCGTTGCAAGCCAAGATACTGCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17331
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 5 (position 48063813)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45852553 |
GRCz11 |
5 |
46452706 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ACAGATGCTGCTGTCAMAAGCACACAATCATCAGAGAAGACAACAGCCAG[A/T]GATTTTTTTKCAACTTCAACAATAGCAWCAATTTTGTCTTTTTCAGAGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17829
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 5 (position 48072456)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45861196 |
GRCz11 |
5 |
46461349 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ATTTTGTTGAAGGACAMAGAGCTGTYAGCAAACCCAWCTGTATTAATCAG[T/C]ACTGATGTTTCAGAGACAATGTCCAGCTCAACAGATCMTGATGTCACAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15511
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 5 (position 48074365)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45863105 |
GRCz11 |
5 |
46463258 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCACAATGATCTCAGAGAAAACARCTCTGTCATCRTCATATTTTYCTTCT[A/T]GATTGCCATCAACAGAATCCSACTTTTCTGGGGATTACAGCTCTGAAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17232
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 5 (position 48074444)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45863184 |
GRCz11 |
5 |
46463337 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGGGGATTACAGCTCTGAAATGCTAAGCAAAGAGTTTACAAMAAGTCCTT[T/A]GCCRTACACTAYAACAAAATCMGGCCTAGAATTCAGTAAAACCCCAAACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33699
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 5 (position 48075458)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45864198 |
GRCz11 |
5 |
46464351 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATCACTATAACACAAAGTTCCAACACTATCACCTCTGTACTTTCAGACA[G/A]TGAGGGTTCTGGTGTTGTAGAAGATGACCGGGAAACTGCACAGTTAGACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20520
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 5 (position 48076010)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45864750 |
GRCz11 |
5 |
46464903 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTACCAGACGATTCTACAGGTTATGTATTCAGAACACCAACAACTAAGT[C/A]ATATGATGATCTAACTGTAAGAACAGATGAGGCAGAAGTGGATGAAACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2210
- Current Status:
-
F2 line generated
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 5 (position 48092692)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
5 |
45881432 |
GRCz11 |
5 |
46481585 |
- KASP Assay ID:
- 554-2637.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TATTTCTACAGGGNNNNNNNNNNNNNNNNNTCACAATCCTTACCTCTATCTGTGTTCTTCCTCTACA[G/A]CAATATGAAAACTGGAGACCGAACCAGCCGGACAGTTTCTTCTCCTCCGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: