zgc:172183

Ensembl ID:
ENSDARG00000078676
ZFIN ID:
ZDB-GENE-080204-57
Description:
Zgc:172183 protein [Source:UniProtKB/TrEMBL;Acc:A8WG44]
Human Orthologue:
C11orf9
Human Description:
chromosome 11 open reading frame 9 [Source:HGNC Symbol;Acc:1181]
Mouse Orthologue:
Gm98
Mouse Description:
predicted gene 98 Gene [Source:MGI Symbol;Acc:MGI:2684944]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44219 Nonsense Mutation detected in F1 DNA During 2018
sa15620 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124749 Nonsense 867 1033 22 27
Genomic Location (Zv9):
Chromosome 25 (position 3962340)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3780265
GRCz11 25 3905924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTCACACATCGGCTCCGCTGTTCCTCAGTAAAGCCAAACGGCCTCCA[C/T]AGCCGCCGGAAGTGAGCGGAGCCACCAAACGCCTGCCTGGCGGACAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124749 Nonsense 999 1033 26 27
Genomic Location (Zv9):
Chromosome 25 (position 3957775)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3775700
GRCz11 25 3901359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAGTCACGTGTGGTCACTTCCTGTCCTGCCCTTTCAGGAGGTCACCTA[C/A]ACTTTCAGACTCTCACATTCAGTGAGTCCATTTCACACAGAACTCTTNNG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Phospholipid levels (plasma): Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium. (View Study)
  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link