
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:172183
- Ensembl ID:
- ENSDARG00000078676
- ZFIN ID:
- ZDB-GENE-080204-57
- Description:
- Zgc:172183 protein [Source:UniProtKB/TrEMBL;Acc:A8WG44]
- Human Orthologue:
- C11orf9
- Human Description:
- chromosome 11 open reading frame 9 [Source:HGNC Symbol;Acc:1181]
- Mouse Orthologue:
- Gm98
- Mouse Description:
- predicted gene 98 Gene [Source:MGI Symbol;Acc:MGI:2684944]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44219 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa15620 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44219
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124749 | Nonsense | 867 | 1033 | 22 | 27 |
- Genomic Location (Zv9):
- Chromosome 25 (position 3962340)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 3780265 GRCz11 25 3905924 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAGTCACACATCGGCTCCGCTGTTCCTCAGTAAAGCCAAACGGCCTCCA[C/T]AGCCGCCGGAAGTGAGCGGAGCCACCAAACGCCTGCCTGGCGGACAACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15620
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000124749 | Nonsense | 999 | 1033 | 26 | 27 |
- Genomic Location (Zv9):
- Chromosome 25 (position 3957775)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 3775700 GRCz11 25 3901359 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACGAGTCACGTGTGGTCACTTCCTGTCCTGCCCTTTCAGGAGGTCACCTA[C/A]ACTTTCAGACTCTCACATTCAGTGAGTCCATTTCACACAGAACTCTTNNG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Phospholipid levels (plasma): Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium. (View Study)
- Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)
- Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: