zgc:165612

Ensembl ID:
ENSDARG00000078655
ZFIN ID:
ZDB-GENE-050809-23
Description:
Novel protein similar to vertebrate inositol polyphosphate-5-phosphatase, 72 kDa (INPP5E, zgc:165612
Human Orthologue:
INPP5E
Human Description:
inositol polyphosphate-5-phosphatase, 72 kDa [Source:HGNC Symbol;Acc:21474]
Mouse Orthologue:
Inpp5e
Mouse Description:
inositol polyphosphate-5-phosphatase E Gene [Source:MGI Symbol;Acc:MGI:1927753]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45232 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114585 Essential Splice Site 359 403 10 11
ENSDART00000143240 Essential Splice Site 540 584 10 10
Genomic Location (Zv9):
Chromosome 5 (position 67577587)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64379228
GRCz11 5 65068225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTATTCGTGCATTTTAATAAACCACTAACTCAAGTGTGGTCCTTCCCA[G/T]CATTCCTCTGGGCGCTGGCCTTTTCGACAGGAGTCTGTACCTCGAAGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link