zgc:171750

Ensembl ID:
ENSDARG00000078638
ZFIN ID:
ZDB-GENE-071004-30
Description:
Zgc:171750 protein [Source:UniProtKB/TrEMBL;Acc:B3DH28]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17761 Nonsense Available for shipment Available now
sa5989 Nonsense Mutation detected in F1 DNA During 2018
sa16510 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106244 Nonsense 390 847 3 3
ENSDART00000115311 Nonsense 381 838 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9805561)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9864445
GRCz11 24 10004831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGATGGAAGTTTTGTTTTTGTGGCACAGCCMAATGGASTGACTYCTCTC[A/T]RGCATCATAAAGGTAAACATCACTTTGGGTCAAAACCTTCCAGTMATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106244 Nonsense 446 847 3 3
ENSDART00000115311 Nonsense 437 838 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9805393)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9864277
GRCz11 24 10004663
KASP Assay ID:
554-3718.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAAACTGGGCCCCAAGCAGTTCTTCAACTGCCAGTACAAGCCAACTAC[C/T]AATCTTCACCTCCATCCAAATGGCARACACTGGTACAGGGTAGTCACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106244 Nonsense 844 847 3 3
ENSDART00000115311 Nonsense 835 838 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9804199)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9863083
GRCz11 24 10003469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCWGGAAGCAATAGGCATTCATCATGGAAGTTGCTTAAGCTGTTGMAA[C/T]AAGTSAAGTCCTAGGTGTTTGTTTGCGGWTTCCTTATGCTCSAGTTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link