A8WGC9_DANRE

Ensembl ID:
ENSDARG00000078617
Description:
LOC100005948 protein [Source:UniProtKB/TrEMBL;Acc:A8WGC9]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28015 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109325 Essential Splice Site 149 538 3 10
Genomic Location (Zv9):
Chromosome 12 (position 47027802)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 45913138
GRCz11 12 46074049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTATGTTAGAGATGATGGCTTTCTGTCTAACATTTATTTGTGTTTCT[A/G]GATGTGAGGTTTAACACTAGCTATACAACTGACACACCAGAGACGACCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link