zgc:194224

Ensembl ID:
ENSDARG00000078606
ZFIN ID:
ZDB-GENE-081022-79
Description:
hypothetical protein LOC799070 [Source:RefSeq peptide;Acc:NP_001124266]
Human Orthologue:
C1orf131
Human Description:
chromosome 1 open reading frame 131 [Source:HGNC Symbol;Acc:25332]
Mouse Orthologue:
2810004N23Rik
Mouse Description:
RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36950 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112999 Essential Splice Site 157 239 4 7
Genomic Location (Zv9):
Chromosome 20 (position 3938947)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3881216
GRCz11 20 4150393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCAGAGGGTGTTTGAGGAGGAAAGAGCCATCATGCTGGGAGCCAGA[G/A]TGAGTTCAACCAAAGAAAAAATCACAATATTAATAACTACTGTATATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link