Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001159802.1
- Ensembl ID:
- ENSDARG00000078605
- Description:
- prostaglandin E receptor 1, subtype EP1b [Source:RefSeq peptide;Acc:NP_001159802]
- Human Orthologue:
- PTGER1
- Human Description:
- prostaglandin E receptor 1 (subtype EP1), 42kDa [Source:HGNC Symbol;Acc:9593]
- Mouse Orthologue:
- Ptger1
- Mouse Description:
- prostaglandin E receptor 1 (subtype EP1) Gene [Source:MGI Symbol;Acc:MGI:97793]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa31498 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31498
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000111218 | Nonsense | 125 | 373 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 6 (position 9397089)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 8163575 GRCz11 6 8399114 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCTGGAGGTGTCCCAGCTGAGGAATACAACAGGGCTGACCCATTATGC[C/T]AGTTCTTAGGAGGCAGTATGGTGTTTTTCGGACTGTGTCCGCTCTTTCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
