
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
myo1hb
- Ensembl ID:
- ENSDARG00000078603
- ZFIN ID:
- ZDB-GENE-070705-355
- Description:
- Novel protein similar to vertebrate myosin IC (MYO1C) [Source:UniProtKB/TrEMBL;Acc:B8JLK6]
- Mouse Orthologue:
- Myo1h
- Mouse Description:
- myosin 1H Gene [Source:MGI Symbol;Acc:MGI:1914674]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31456 | Nonsense | Available for shipment | Available now |
sa1578 | Essential Splice Site | Available for shipment | Available now |
sa45209 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa33637 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa31456
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112968 | Nonsense | 57 | 1021 | 2 | 31 |
ENSDART00000142826 | Nonsense | 57 | 993 | 2 | 30 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33598506)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31360738 GRCz11 5 31960891 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGTTAGACCTACATTGGGACCCTTCTGGTGTCAGTTAATCCATATAAA[G/T]AGTTGGGTATCTACACCAAGAAACAAATGGACATTTACATGGGAGTCAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1578
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112968 | Essential Splice Site | 561 | 1021 | 16 | 31 |
ENSDART00000142826 | Essential Splice Site | 535 | 993 | 16 | 30 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33607560)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31369792 GRCz11 5 31969945 - KASP Assay ID:
- 554-1521.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCATTGCTTCCACACTATTGAGCCTGATGGCAAGAAAAGACCCGAGACGG[T/C]ACAGTAAAATGATATGTGACAAGTGAATGCATTTTTAATGATGATTTTCT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa45209
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112968 | Nonsense | 807 | 1021 | 24 | 31 |
ENSDART00000142826 | Nonsense | 781 | 993 | 24 | 30 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33614560)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31376792 GRCz11 5 31976945 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATTTTATTGTATTTTATTTTTTCTTTTCTATAAATGAATCTACAGGCCT[C/A]GGTTCTCTTGCGTAACCTGTACACACGCCTCCTTGTTAGGAAGTATGTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33637
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112968 | Essential Splice Site | 928 | 1021 | 27 | 31 |
ENSDART00000142826 | Essential Splice Site | 902 | 993 | 27 | 30 |
- Genomic Location (Zv9):
- Chromosome 5 (position 33616847)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 31379079 GRCz11 5 31979232 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTGGAGGAGGCCAAAATCAAACAGAGGGTGAATTACAGCTCTCTAAAAG[G/A]TCAAATTTCAGTGTTGTTCATTAATTAAACATCTCAAATTGTGTGAAATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: