efha2

Ensembl ID:
ENSDARG00000078599
ZFIN ID:
ZDB-GENE-070713-1
Human Orthologue:
EFHA2
Human Description:
EF-hand domain family, member A2 [Source:HGNC Symbol;Acc:27820]
Mouse Orthologue:
Efha2
Mouse Description:
EF-hand domain family, member A2 Gene [Source:MGI Symbol;Acc:MGI:1925756]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32633 Nonsense Mutation detected in F1 DNA During 2018
sa7356 Missense Mutation detected in F1 DNA During 2018
sa32634 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24836 Nonsense Mutation detected in F1 DNA During 2018
sa45070 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113266 Nonsense 79 503 1 15
Genomic Location (Zv9):
Chromosome 1 (position 15139157)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15704325
GRCz11 1 16397262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGGTGTTGTATTATTATTATTCAGAAATGTGCGGATTTGGAGGGAGG[A/T]AAGCCCCGATAAACCGAACAGTCTGTCGGGCTCTGCTGCCTTCACTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7356
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113266 Missense 226 503 6 15
Genomic Location (Zv9):
Chromosome 1 (position 15164563)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15729731
GRCz11 1 16422668
KASP Assay ID:
554-4148.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAAAATTGCCTTTAACATGTTTGACGCTGATGGTAACCAGATGGTGG[A/T]TAAACGAGAATTTATGGTGGTGAGTGGATAAAGTGKAGATTTWAAGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113266 Essential Splice Site 334 503 10 15
Genomic Location (Zv9):
Chromosome 1 (position 15182831)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15747999
GRCz11 1 16440936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTGGCAAGAAGGGGAAGGCGGAGCTAACGTTTGACGACTTTTACAG[G/A]TATGACTGATTGAGCACTGAAAACATGGCACTTATTCATCTCTGCTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24836
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113266 Nonsense 427 503 12 15
Genomic Location (Zv9):
Chromosome 1 (position 15194797)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15759965
GRCz11 1 16452902
KASP Assay ID:
554-7463.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCGCCATTGCCATGCAGATGTACAACTTTGCCTGCCGTTCCATTGGA[C/T]AAGGTCAAATACTTCATTTGAATACATGTATAAAATACATAGTGTGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113266 Essential Splice Site 427 503 12 15
Genomic Location (Zv9):
Chromosome 1 (position 15194801)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 15759969
GRCz11 1 16452906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCATTGCCATGCAGATGTACAACTTTGCCTGCCGTTCCATTGGACAAG[G/A]TCAAATACTTCATTTGAATACATGTATAAAATACATAGTGTGATACAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link