A5PLI8_DANRE

Ensembl ID:
ENSDARG00000078581
Description:
LOC100149876 protein [Source:UniProtKB/TrEMBL;Acc:A5PLI8]
Human Orthologue:
C5orf41
Human Description:
chromosome 5 open reading frame 41 [Source:HGNC Symbol;Acc:24050]
Mouse Orthologue:
A930001N09Rik
Mouse Description:
RIKEN cDNA A930001N09 gene Gene [Source:MGI Symbol;Acc:MGI:1924378]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43716 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110274   None 373 None 4
ENSDART00000127910 Nonsense 476 717 3 8
Genomic Location (Zv9):
Chromosome 21 (position 39971989)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41171904
GRCz11 21 41568785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAGGAAGAGGAGGATGACGAGGATTATGAGGGAGATAAAGATGACTA[T/A]GCTAGTGATGCATTCTCAGAGCCAGGTATGAAATGTGTTTTTGTTTTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link