
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
C17orf63 (1 of 2)
- Ensembl ID:
- ENSDARG00000078578
- Description:
- chromosome 17 open reading frame 63 [Source:HGNC Symbol;Acc:25563]
- Human Orthologue:
- C17orf63
- Human Description:
- chromosome 17 open reading frame 63 [Source:HGNC Symbol;Acc:25563]
- Mouse Orthologue:
- BC017647
- Mouse Description:
- cDNA sequence BC017647 Gene [Source:MGI Symbol;Acc:MGI:2384939]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35839 | Nonsense | Available for shipment | Available now |
sa28422 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35839
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111228 | Nonsense | 209 | 596 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 15 (position 15400567)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 16445530 GRCz11 15 16381552 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGCCAGGCTCACCAACCGCCAGTACCACACCACACCCTAAACCACCAA[C/T]AGACTCTCATGCAGCAGCAGTTGTCCGCTCCACAAGGACTACGGCATTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28422
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111228 | Nonsense | 362 | 596 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 15 (position 15400106)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 16445069 GRCz11 15 16381091 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCGAGCTCTCGAGTGTGCCCACATCCTACTGTGGGTCCTCCATCTTCTTG[C/A]ATTCTTGGAAATTCTGACAAAGGCGGTCCTGCCTCTGCTCTGCCACTGCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: