si:dkey-258f14.5

Ensembl ID:
ENSDARG00000078567
ZFIN ID:
ZDB-GENE-081104-397
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0V0V8]
Human Orthologue:
LONRF1
Human Description:
LON peptidase N-terminal domain and ring finger 1 [Source:HGNC Symbol;Acc:26302]
Mouse Orthologue:
Lonrf1
Mouse Description:
LON peptidase N-terminal domain and ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:3609241]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14409 Nonsense Available for shipment Available now
sa21223 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109803 Nonsense 348 699 6 13
ENSDART00000144516 Nonsense 400 751 5 12
Genomic Location (Zv9):
Chromosome 8 (position 14296515)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13741859
GRCz11 8 13779564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGTTAGCTCCGCYCCYCAGCTGGGTGACCCAGATAAAGGYGCACTGT[T/A]GAAGAGAAAGCTCTCCGTGTCTGAAGCAGGGCCCGGCATYGCACACAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21223
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109803 Nonsense 405 699 7 13
ENSDART00000144516 Nonsense 457 751 6 12
Genomic Location (Zv9):
Chromosome 8 (position 14296877)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13742221
GRCz11 8 13779926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCATCAAACTCTGCCAAAAAACCTGCTGGACCCGAACGATTTTGAATG[C/A]TCTCTCTGCATGAGGTGAGGAAAGAGTGGTGCTCAAGTCTATCTGACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link