slc9a5

Ensembl ID:
ENSDARG00000078560
ZFIN ID:
ZDB-GENE-080225-43
Description:
sodium/hydrogen exchanger 5 [Source:RefSeq peptide;Acc:NP_001106943]
Human Orthologue:
SLC9A5
Human Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 5 [Source:HGNC Symbol;Acc:11078]
Mouse Orthologue:
Slc9a5
Mouse Description:
solute carrier family 9 (sodium/hydrogen exchanger), member 5 Gene [Source:MGI Symbol;Acc:MGI:268554

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2382 Essential Splice Site F2 line generated During 2018
sa34118 Nonsense Mutation detected in F1 DNA During 2018
sa12316 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2382
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081338 Essential Splice Site 268 970 3 16
Genomic Location (Zv9):
Chromosome 7 (position 36085686)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34359529
GRCz11 7 34631006
KASP Assay ID:
554-3330.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCATCATYGTCTTTGGCGAGTCATTGCTCAATGATGCTGTCACTGTGG[T/G]AAGTCAGTTTTTAAAAAATAGAATMTTCTCTTGTATTACTCACRTTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081338 Nonsense 362 970 6 16
Genomic Location (Zv9):
Chromosome 7 (position 36092036)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34365879
GRCz11 7 34637356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATGACAATGTTGATTCACCACAGGTTGACTTTCTGTGGAATTGGCTG[T/A]AACAAATATGTGGAGGCTAATATATCCCAGAAGTCCCGGACTACTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081338 Nonsense 948 970 16 16
Genomic Location (Zv9):
Chromosome 7 (position 36106369)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34380212
GRCz11 7 34651689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCACYTGCTGCACAATCTGCAGGAAAGAGAAGGAATCCTTGTGTTTA[T/A]CTTAGGAGTCTGGTGACAGTGCCACCTACTGGTGCRGAGCCACATAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link