
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
GLP2R
- Ensembl ID:
- ENSDARG00000078548
- Description:
- glucagon-like peptide 2 receptor [Source:HGNC Symbol;Acc:4325]
- Human Orthologue:
- GLP2R
- Human Description:
- glucagon-like peptide 2 receptor [Source:HGNC Symbol;Acc:4325]
- Mouse Orthologue:
- Glp2r
- Mouse Description:
- glucagon-like peptide 2 receptor Gene [Source:MGI Symbol;Acc:MGI:2136733]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13102 | Nonsense | Available for shipment | Available now |
sa10676 | Nonsense | Available for shipment | Available now |
sa35173 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa13102
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109713 | Nonsense | 95 | 493 | 3 | 13 |
- Genomic Location (Zv9):
- Chromosome 12 (position 340237)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 322601 GRCz11 12 328542 - KASP Assay ID:
- 2260-4757.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCACCGTCAACGGCACTTGGWAAACTGAGGAGAACTCCTCCASCGTATGG[A/T]GAAATCAGTCAGAGTGCGAAAACCATTAWTTTTTCAAGTCCGAGGTGAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10676
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109713 | Nonsense | 104 | 493 | 3 | 13 |
- Genomic Location (Zv9):
- Chromosome 12 (position 340208)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 322572 GRCz11 12 328513 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGAACTCCTCCASCGTATGGAGAAATCAGTCAGAGTGCGAAAACCATTA[T/A]TTTTTCAAGTCCGAGGTGAATATTGCAGCCATACAGTGACGTATGGTGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35173
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109713 | Essential Splice Site | 145 | 493 | 5 | 13 |
- Genomic Location (Zv9):
- Chromosome 12 (position 338298)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 320662 GRCz11 12 326603 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTATTTATAGTCGCAAAGCAATGAATGTGCTTTACCTGTTGTTGTTTTC[A/T]GGAAGCTTCACTGTACGAGGAACTACATCCACATCAATCTCTTTGTATCG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: