si:dkey-266m15.6

Ensembl ID:
ENSDARG00000078508
ZFIN ID:
ZDB-GENE-070705-443
Description:
Novel protein with a von Willebrand factor type D domain [Source:UniProtKB/TrEMBL;Acc:A5WVI8]
Mouse Orthologue:
Kcp
Mouse Description:
kielin/chordin-like protein Gene [Source:MGI Symbol;Acc:MGI:2141640]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9908 Essential Splice Site Available for shipment Available now
sa16495 Essential Splice Site Available for shipment Available now
sa23220 Nonsense Available for shipment Available now
sa23219 Nonsense Available for shipment Available now
sa10097 Nonsense Available for shipment Available now
sa36562 Nonsense Mutation detected in F1 DNA During 2018
sa23218 Essential Splice Site Available for shipment Available now
sa36561 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23217 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101525 Essential Splice Site 218 2200 2 48
ENSDART00000132399   None 330 None 8
ENSDART00000134194   None 204 None 2
ENSDART00000146536   None 217 None 4
Genomic Location (Zv9):
Chromosome 18 (position 6060566)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7015667
GRCz11 18 6974629
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGTCAYGTTCTCCAGGGCTGCAGGAAATACAACCAGCAAGTTTAGCG[T/A]GAGTTTATTTTAAATGTCTGTACATTACTTACATTTTTGAATCTCTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101525 Essential Splice Site 308 2200 4 48
ENSDART00000132399   None 330 None 8
ENSDART00000134194   None 204 None 2
ENSDART00000146536   None 217 None 4
Genomic Location (Zv9):
Chromosome 18 (position 6054729)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7009830
GRCz11 18 6968792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAACCTGCATGGCATCATGACCATGCTGGAGAYGCTGAAGAGACAGG[T/C]ACATGRAGAATACACTKMAAATAAACATWTTGGTACTGYGATTGTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101525 Nonsense 456 2200 9 48
ENSDART00000132399   None 330 None 8
ENSDART00000134194   None 204 None 2
ENSDART00000146536   None 217 None 4
Genomic Location (Zv9):
Chromosome 18 (position 6048593)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7003694
GRCz11 18 6962656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTAAACCGGCATGCCTGTGTCTGTTTGCAGAACAGTCGGGTGTCTTG[T/A]AACACCATTCAGTGTCCGTCAACCCCGTGTCCAAACCCCTACAGGAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101525 Nonsense 1043 2200 26 48
ENSDART00000132399 Nonsense 111 330 4 8
ENSDART00000134194   None 204 None 2
ENSDART00000146536   None 217 None 4
Genomic Location (Zv9):
Chromosome 18 (position 6027652)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6982753
GRCz11 18 6941715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTATGCATTTTTTTTTTTTGTGTTTTATAGAATGGAAATGTCCAGTG[T/A]CTGATGAAGAGATGTCCAGCAGTTCATTGTGATAATTCATTCGTTCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10097
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101525 Nonsense 1067 2200 26 48
ENSDART00000132399 Nonsense 135 330 4 8
ENSDART00000134194   None 204 None 2
ENSDART00000146536   None 217 None 4
Genomic Location (Zv9):
Chromosome 18 (position 6027580)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6982681
GRCz11 18 6941643
KASP Assay ID:
2261-1777.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCATTGTGATAATKCATTCGTTCAGGCAGGAGAGTGTTGTCGGCAGTG[T/A]CCAGGTCATACAWTYACTTRTGCATCACATTATGTATTTCCRAGTATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101525 Nonsense 1156 2200 28 48
ENSDART00000132399 Nonsense 224 330 6 8
ENSDART00000134194   None 204 None 2
ENSDART00000146536   None 217 None 4
Genomic Location (Zv9):
Chromosome 18 (position 6024835)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6979936
GRCz11 18 6938898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGTGCTACATTCGCAGACCCATCAGACTCATGTAGGACGTGTGTTTG[T/A]CGTGATGGGACAGTCACATGTCACAGTAATCAGTGTCAGCGCATCGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101525 Essential Splice Site 1392 2200 33 48
ENSDART00000132399   None 330 None 8
ENSDART00000134194   None 204 None 2
ENSDART00000146536   None 217 None 4
Genomic Location (Zv9):
Chromosome 18 (position 6014427)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6969528
GRCz11 18 6928490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTGCACCACATGGCATCATTTTTAAGTGTACTCTGCTTGTGTTTTCT[A/T]GAGTGGAGTGGTGTTGTGTGAGAAGAAGATGTGCTCTAAGAAGTGCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101525 Essential Splice Site 1664 2200 38 48
ENSDART00000132399   None 330 None 8
ENSDART00000134194   None 204 None 2
ENSDART00000146536   None 217 None 4
Genomic Location (Zv9):
Chromosome 18 (position 6008576)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6963677
GRCz11 18 6922639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAACATCCTGCACAGCAGCTCTGATTCCTGCTGTCCTGTCTGCACAC[G/A]TTAGTATGAACAGATATTATGCATCAATTAAAAAAAAAATGATTGATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101525 Essential Splice Site 1941 2200 45 48
ENSDART00000132399   None 330 None 8
ENSDART00000134194   None 204 None 2
ENSDART00000146536 Essential Splice Site 28 217 2 4
Genomic Location (Zv9):
Chromosome 18 (position 5994034)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6949135
GRCz11 18 6908097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTAATGTGTGTTGAACATTGACAAATTTGTAATGATTTTAATCCCTC[A/C]GGTTGATTATGAGCCAGTCTCCCTGCCGTATCTTAAAGAGCCTTATATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link