wnt8a

Ensembl ID:
ENSDARG00000078507
ZFIN ID:
ZDB-GENE-980526-332
Description:
wnt8-like protein 2 [Source:RefSeq peptide;Acc:NP_001018637]
Human Orthologue:
WNT8A
Human Description:
wingless-type MMTV integration site family, member 8A [Source:HGNC Symbol;Acc:12788]
Mouse Orthologue:
Wnt8a
Mouse Description:
wingless-related MMTV integration site 8A Gene [Source:MGI Symbol;Acc:MGI:107924]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31997 Nonsense Available for shipment Available now
sa11601 Essential Splice Site Available for shipment Available now
sa1188 Essential Splice Site F2 line generated During 2018
sa42419 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105649 Nonsense 14 354 1 6
ENSDART00000147756 Nonsense 14 353 1 6

The following transcripts of ENSDARG00000078507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 35625712)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34154989
GRCz11 14 34495303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTAAAATAATGGCTTACTTCTTCCGTTGGGCCTTTCTATTCCCTATTT[G/A]GGACAAAGCTATCCTTGGACACACTTGGTAAGTGGATCATCAACTGCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11601
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105649 Essential Splice Site 35 354 None 6
ENSDART00000147756 Essential Splice Site 35 353 None 6

The following transcripts of ENSDARG00000078507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 35625978)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34155255
GRCz11 14 34495569
KASP Assay ID:
2260-7758.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGWGGCGAAGCGTGAGTGTCAAAACACCCATATCTYTTCCTATCTTTCC[A/T]GGCTTATYTTACCTATGCAAATAGTGTGCGGGTTGGGGCACAGAGTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1188
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105649 Essential Splice Site 122 354 4 6
ENSDART00000147756 Essential Splice Site 121 353 4 6

The following transcripts of ENSDARG00000078507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 35626323)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34155600
GRCz11 14 34495914
KASP Assay ID:
554-1097.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGATCTAAACGAATGCGGGTGTGACAGCTCGAGGAACGGCAGACTTG[G/A]TAAGAACAGTTTTGGCCAATTCGCATACTAAAACATCCTAATATAGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105649 Nonsense 197 354 6 6
ENSDART00000147756 Nonsense 196 353 6 6

The following transcripts of ENSDARG00000078507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 35627558)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 34156835
GRCz11 14 34497149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGATGTCATGGCATGTCAGAAAGTTGCACAATGCAAACATGCTGGATG[C/T]AACTGGCTGACTTCCGTGAGATTGGCAATTACCTGAAAGTGAAGCACGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link