si:ch211-284d12.3

Ensembl ID:
ENSDARG00000078489
ZFIN ID:
ZDB-GENE-070912-280
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S5K8]
Mouse Orthologue:
Zan
Mouse Description:
zonadhesin Gene [Source:MGI Symbol;Acc:MGI:106656]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19869 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33019 Nonsense Mutation detected in F1 DNA During 2018
sa39929 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44549 Nonsense Mutation detected in F1 DNA During 2018
sa6863 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109324 Essential Splice Site 40 667 3 9
ENSDART00000144438   None 56 None 2
Genomic Location (Zv9):
Chromosome 2 (position 47396075)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47401351
GRCz11 2 47253043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTTGATTTTGTATTGTCCTTTAATCACCTCTCCCTCCTACGCTGTA[G/A]ATTATTTGGCAAAGTGTGACTTTGGCAGTGACTTGCCATCATCTTGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109324 Nonsense 117 667 4 9
ENSDART00000144438   None 56 None 2
Genomic Location (Zv9):
Chromosome 2 (position 47404299)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47409575
GRCz11 2 47261267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATGAAAAAAGCTCTGATCTCAATGTTCTGCTAGTGGATGGCATTCTG[A/T]AAACGCTGATTTGGACCTCAGAGGGTTCCGGCGTTGGAGACTGGAGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109324 Essential Splice Site 176 667 5 9
ENSDART00000144438   None 56 None 2
Genomic Location (Zv9):
Chromosome 2 (position 47406207)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47411483
GRCz11 2 47263175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGAAAAACTGCTTTTGACAGAATGGGAATACACAAGGGACGATGCGG[T/A]GAGTGGCTAATGATTATTATTATTTTCTTGATGACTTCACCAAGACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109324 Nonsense 271 667 6 9
ENSDART00000144438   None 56 None 2
Genomic Location (Zv9):
Chromosome 2 (position 47406591)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47411867
GRCz11 2 47263559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGGAGGTGCAGAATGAGAAGAAAGAAGAATCGCACGTGACCTCCATT[C/T]AACAGGTCAATGTCAACATATACGGTCTGAGAGTGTCCATGATGAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109324 Nonsense 510 667 8 9
ENSDART00000144438   None 56 None 2
Genomic Location (Zv9):
Chromosome 2 (position 47412215)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47417491
GRCz11 2 47269183
KASP Assay ID:
554-5199.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCAGCCTAGATGCCGCAGGGCCTTGTGGGAATTGTGAAGAGCGCTG[C/A]GAGTGTGACGATGGCTTTATACTCAGCGGAGGAGAGTGTGTGCWGGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link