znrf2

Ensembl ID:
ENSDARG00000078486
ZFIN ID:
ZDB-GENE-060929-24
Description:
E3 ubiquitin-protein ligase ZNRF2 [Source:RefSeq peptide;Acc:NP_001070196]
Human Orthologue:
ZNRF2
Human Description:
zinc and ring finger 2 [Source:HGNC Symbol;Acc:22316]
Mouse Orthologue:
Znrf2
Mouse Description:
zinc and ring finger 2 Gene [Source:MGI Symbol;Acc:MGI:1196246]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6452 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111286 Nonsense 28 71 2 3
Genomic Location (Zv9):
Chromosome 16 (position 57276150)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 54053453
GRCz11 16 53737396
KASP Assay ID:
554-4553.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTCCACTGTTCCTCAGAGGAYGTGCTGTCGAAGGATGCTGGAGAATG[T/A]GCAATATGTCTGGAGGAGCTGCTGCAGGGAGACACCATCGCACGCCTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link