si:dkey-253d23.7

Ensembl ID:
ENSDARG00000078476
ZFIN ID:
ZDB-GENE-050208-409
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LWP2]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24081 Nonsense Mutation detected in F1 DNA During 2018
sa45753 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081439 Nonsense 350 636 2 2
ENSDART00000141526   None 279 None 3
Genomic Location (Zv9):
Chromosome 22 (position 10009036)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9869204
GRCz11 22 9898886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGATCATGTTTGCTCCACGTGTGGCAAGAGTTTTTTAATAAATGCGTA[T/A]TTAAAAATACATGAAAAAGCTCACTCTACAGAAAGACCTCATAAATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081439 Nonsense 514 636 2 2
ENSDART00000141526   None 278 None 3
Genomic Location (Zv9):
Chromosome 22 (position 10008544)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9868712
GRCz11 22 9898394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAGAATCTGCACAAATGTGATCAGTGTGGGAAAAGTTTCAGAAGATA[C/A]GATGTTTTTAAAGGTCATCTTCTGAGTCATTCTAGAGAGAGAATCTATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link