wu:fc07e02

Ensembl ID:
ENSDARG00000078473
ZFIN IDs:
ZDB-GENE-030131-2424, ZDB-GENE-040912-175
Description:
nuclear ubiquitous casein and cyclin-dependent kinases substrate [Source:RefSeq peptide;Acc:NP_0010
Human Orthologue:
NUCKS1
Human Description:
nuclear casein kinase and cyclin-dependent kinase substrate 1 [Source:HGNC Symbol;Acc:29923]
Mouse Orthologue:
Nucks1
Mouse Description:
nuclear casein kinase and cyclin-dependent kinase substrate 1 Gene [Source:MGI Symbol;Acc:MGI:193481

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41902 Nonsense Mutation detected in F1 DNA During 2018
sa45440 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102858 Nonsense 173 305 6 8
Genomic Location (Zv9):
Chromosome 11 (position 39780319)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38278575
GRCz11 11 38545780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCAGTGAGGATGAGGAGAAGGATGAGGAAGAACAGGCCTTCCTGGAC[C/T]GTAAGTGTCATCATCATTATCTTTTATAAAATTCCTCATTGTTGAAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102858 Essential Splice Site 226 305 7 8
Genomic Location (Zv9):
Chromosome 11 (position 39777125)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38275381
GRCz11 11 38542586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAGAAGAAGGAGAAGAAATCCCCCAAACCCCGGCTAAAGGCTACAGG[T/C]AAGCAATAGCACTCTTGAATATTTAGGATTTGGGAAAATAAAGGGCAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link