zgc:162225

Ensembl ID:
ENSDARG00000078472
ZFIN ID:
ZDB-GENE-070410-42
Description:
heat shock factor protein 5 [Source:RefSeq peptide;Acc:NP_001082945]
Human Orthologue:
HSF5
Human Description:
heat shock transcription factor family member 5 [Source:HGNC Symbol;Acc:26862]
Mouse Orthologue:
Hsf5
Mouse Description:
heat shock transcription factor family member 5 Gene [Source:MGI Symbol;Acc:MGI:2685585]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45184 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113934 Nonsense 171 416 3 6
Genomic Location (Zv9):
Chromosome 5 (position 3094021)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150672.1 58624
GRCz11 5 3107948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGTTCTGCCCAGCTCTCAGGAGGTGCAGCCCATCAGCAGCCAGAGTA[T/A]GAGCAAAGCCCAATGACTGGCCACTCCTGGATCTTTCCCTGCGCTGATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link