si:dkey-254e1.2

Ensembl ID:
ENSDARG00000078452
ZFIN ID:
ZDB-GENE-091118-52
Human Orthologue:
HMOX2
Human Description:
heme oxygenase (decycling) 2 [Source:HGNC Symbol;Acc:5014]
Mouse Orthologue:
Hmox2
Mouse Description:
heme oxygenase (decycling) 2 Gene [Source:MGI Symbol;Acc:MGI:109373]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10015 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112800 Nonsense 294 318 5 5
ENSDART00000140123   None 287 None 6
Genomic Location (Zv9):
Chromosome 3 (position 12986244)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12018469
GRCz11 3 11958669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCAGTGGYGGGKCATCWTATGTTTGTCAAATAGCCAAGACTGTGCTT[A/T]AAAATCCCTCCGGTCAAGTCCTATTGGCTGCCTGGATCGCTGCTCTCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link