
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC100001171
- Ensembl ID:
- ENSDARG00000078448
- Human Orthologue:
- GPR137B
- Human Description:
- G protein-coupled receptor 137B [Source:HGNC Symbol;Acc:11862]
- Mouse Orthologue:
- Gpr137b
- Mouse Description:
- G protein-coupled receptor 137B Gene [Source:MGI Symbol;Acc:MGI:1891463]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35600 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35600
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000031858 | Essential Splice Site | 206 | 373 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 13 (position 51137909)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 49849006 GRCz11 13 50162249 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAACTCTGTCTATTTTATTTATTGTGACTGGACTATATGCTGTTGTGTGC[A/T]GGGCACTTCTGTGTGTCAGGTGACATTGATTGGGGTGACGGTGGTCCTGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Working memory: Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: