si:rp71-15d4.2

Ensembl ID:
ENSDARG00000078434
ZFIN ID:
ZDB-GENE-081104-484
Description:
zinc finger protein 692 [Source:RefSeq peptide;Acc:NP_001116748]
Human Orthologue:
ZNF692
Human Description:
zinc finger protein 692 [Source:HGNC Symbol;Acc:26049]
Mouse Orthologue:
Zfp692-ps
Mouse Description:
zinc finger protein 692, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:2144276]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18471 Nonsense Available for shipment Available now
sa1641 Nonsense F2 line generated During 2018
sa41179 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113340 Nonsense 192 503 3 11
ENSDART00000134124 Nonsense 192 503 4 12

The following transcripts of ENSDARG00000078434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20523121)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19953018
GRCz11 8 19985103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGGAACCARTCACAGATACAGAAAGACAAGAAATGATGACTAGATTA[A/T]AAACCAGACAGCAACAGAGAGAAGATGCTGGCAMTRACACAAATAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1641
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113340 Nonsense 465 503 11 11
ENSDART00000134124 Nonsense 465 503 12 12

The following transcripts of ENSDARG00000078434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20535669)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19965566
GRCz11 8 19997651
KASP Assay ID:
554-1581.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAGAGAGAYAATGTTACGGCTCACCGTAGCAAGAGTCACCCAGACTA[T/G]AATACAGGCACTCTGGAAAGATCTCTTCCCCTTCCTCCCTCTGACCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113340 Nonsense 499 503 11 11
ENSDART00000134124 Nonsense 499 503 12 12

The following transcripts of ENSDARG00000078434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20535769)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19965666
GRCz11 8 19997751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCATCCCTCGAGGCACCGCGGATCTTCCCCTTCTGTTTCCAAGAAT[C/T]AACCCACTGCAGAATAAGAGTTGTGACAACAGTTTGAACACTCTTGACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link