Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
vtg4
- Ensembl ID:
- ENSDARG00000078429
- ZFIN ID:
- ZDB-GENE-001201-3
- Description:
- hypothetical protein LOC678536 [Source:RefSeq peptide;Acc:NP_001038759]
Alleles
There are 6 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa11872 | Essential Splice Site | Available for shipment | Available now |
| sa16928 | Essential Splice Site | Available for shipment | Available now |
| sa10877 | Nonsense | Available for shipment | Available now |
| sa37523 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa39374 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa12457 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11872
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000105237 | Essential Splice Site | 156 | 1358 | 5 | 28 |
| ENSDART00000109411 | None | 1135 | None | 23 | |
| ENSDART00000114647 | Essential Splice Site | 156 | 1362 | 5 | 28 |
| ENSDART00000136837 | Essential Splice Site | 161 | 1363 | 5 | 28 |
The following transcripts of ENSDARG00000078429 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 25263073)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 24762979 GRCz11 22 24790603 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCTGAGRTATTTTGAATTCTGCWATCTCAYCATTTGACTTGTTCTTGAA[G/A]GCTGGAGCTCAGGGAGTGTGCAGRACACACTATGTCATCAATGAGGATCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16928
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000105237 | Essential Splice Site | 259 | 1358 | 7 | 28 |
| ENSDART00000109411 | Essential Splice Site | 36 | 1135 | 2 | 23 |
| ENSDART00000114647 | Essential Splice Site | 259 | 1362 | 7 | 28 |
| ENSDART00000136837 | Essential Splice Site | 264 | 1363 | 7 | 28 |
The following transcripts of ENSDARG00000078429 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 25262559)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 24762465 GRCz11 22 24790089 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACATTCAACTAGAAAATTAAGTCAAAGTTTMAGAAAYAATGATTTGTTTC[A/T]GACAAACCTTGGCTTTTGTTGAGATTGAGAAGACCCCTGTCGTTCCATTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10877
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000105237 | Nonsense | 649 | 1358 | 14 | 28 |
| ENSDART00000109411 | Nonsense | 426 | 1135 | 9 | 23 |
| ENSDART00000114647 | Nonsense | 649 | 1362 | 14 | 28 |
| ENSDART00000136837 | Nonsense | 654 | 1363 | 14 | 28 |
The following transcripts of ENSDARG00000078429 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 25260781)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 24760687 GRCz11 22 24788311 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATCTTTGTCCATTAAGCKCCTCTWATGATTGGRGCTGCTGGTAGTGCCTA[T/A]ATGATCAATGATGCTGCCACCATCYTGCCCAGAGCTGTTGTAGCTAAAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37523
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000105237 | Nonsense | 1152 | 1358 | 24 | 28 |
| ENSDART00000109411 | Nonsense | 929 | 1135 | 19 | 23 |
| ENSDART00000114647 | None | 1362 | None | 28 | |
| ENSDART00000136837 | Nonsense | 1157 | 1363 | 24 | 28 |
The following transcripts of ENSDARG00000078429 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 25257590)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 24757496 GRCz11 22 24785120 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAGTGCCACAAAGGATACTAGCAGTGGAAGCGCTGCAGCTAGCTTTGAA[C/T]AAATGCAGAAAAAGGTTAGTCTTAGCTCTTTGTCTATGAAACAAAACCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39374
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000105237 | None | 1358 | None | 28 | |
| ENSDART00000109411 | None | 1135 | None | 23 | |
| ENSDART00000114647 | Nonsense | 1073 | 1362 | 22 | 28 |
| ENSDART00000136837 | None | 1363 | None | 28 |
The following transcripts of ENSDARG00000078429 do not overlap with this mutation:
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 25205482)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 24705388 GRCz11 22 24733012 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTGAGGGAAATCCTGGACACTGAAGCTAAAAATGCACCTGTTTCTTCT[G/T]AAAGCAGCAGCAGTCGTAACAGTCGCAGCAGCAGCAGCCGCAGCACCAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12457
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000105237 | None | 1358 | None | 28 | |
| ENSDART00000109411 | None | 1135 | None | 23 | |
| ENSDART00000114647 | Nonsense | 1154 | 1362 | 24 | 28 |
| ENSDART00000136837 | None | 1363 | None | 28 |
The following transcripts of ENSDARG00000078429 do not overlap with this mutation:
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 22 (position 25204708)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 24704614 GRCz11 22 24732238 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATAGCGCCACAAAGGATACTAGCAGTGGAAGTGCTGSAGCTAGCTTTGAR[C/T]AAATGCAGAAACAGGTTAGTCTCAGCTATTTGCCCMTGAAGCAAACCCAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
