vtg4

Ensembl ID:
ENSDARG00000078429
ZFIN ID:
ZDB-GENE-001201-3
Description:
hypothetical protein LOC678536 [Source:RefSeq peptide;Acc:NP_001038759]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11872 Essential Splice Site Available for shipment Available now
sa16928 Essential Splice Site Available for shipment Available now
sa10877 Nonsense Available for shipment Available now
sa37523 Nonsense Mutation detected in F1 DNA During 2018
sa39374 Nonsense Mutation detected in F1 DNA During 2018
sa12457 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105237 Essential Splice Site 156 1358 5 28
ENSDART00000109411   None 1135 None 23
ENSDART00000114647 Essential Splice Site 156 1362 5 28
ENSDART00000136837 Essential Splice Site 161 1363 5 28

The following transcripts of ENSDARG00000078429 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25263073)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24762979
GRCz11 22 24790603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGAGRTATTTTGAATTCTGCWATCTCAYCATTTGACTTGTTCTTGAA[G/A]GCTGGAGCTCAGGGAGTGTGCAGRACACACTATGTCATCAATGAGGATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105237 Essential Splice Site 259 1358 7 28
ENSDART00000109411 Essential Splice Site 36 1135 2 23
ENSDART00000114647 Essential Splice Site 259 1362 7 28
ENSDART00000136837 Essential Splice Site 264 1363 7 28

The following transcripts of ENSDARG00000078429 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25262559)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24762465
GRCz11 22 24790089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTCAACTAGAAAATTAAGTCAAAGTTTMAGAAAYAATGATTTGTTTC[A/T]GACAAACCTTGGCTTTTGTTGAGATTGAGAAGACCCCTGTCGTTCCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105237 Nonsense 649 1358 14 28
ENSDART00000109411 Nonsense 426 1135 9 23
ENSDART00000114647 Nonsense 649 1362 14 28
ENSDART00000136837 Nonsense 654 1363 14 28

The following transcripts of ENSDARG00000078429 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25260781)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24760687
GRCz11 22 24788311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTTGTCCATTAAGCKCCTCTWATGATTGGRGCTGCTGGTAGTGCCTA[T/A]ATGATCAATGATGCTGCCACCATCYTGCCCAGAGCTGTTGTAGCTAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105237 Nonsense 1152 1358 24 28
ENSDART00000109411 Nonsense 929 1135 19 23
ENSDART00000114647   None 1362 None 28
ENSDART00000136837 Nonsense 1157 1363 24 28

The following transcripts of ENSDARG00000078429 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25257590)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24757496
GRCz11 22 24785120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGTGCCACAAAGGATACTAGCAGTGGAAGCGCTGCAGCTAGCTTTGAA[C/T]AAATGCAGAAAAAGGTTAGTCTTAGCTCTTTGTCTATGAAACAAAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105237   None 1358 None 28
ENSDART00000109411   None 1135 None 23
ENSDART00000114647 Nonsense 1073 1362 22 28
ENSDART00000136837   None 1363 None 28

The following transcripts of ENSDARG00000078429 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25205482)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24705388
GRCz11 22 24733012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGAGGGAAATCCTGGACACTGAAGCTAAAAATGCACCTGTTTCTTCT[G/T]AAAGCAGCAGCAGTCGTAACAGTCGCAGCAGCAGCAGCCGCAGCACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105237   None 1358 None 28
ENSDART00000109411   None 1135 None 23
ENSDART00000114647 Nonsense 1154 1362 24 28
ENSDART00000136837   None 1363 None 28

The following transcripts of ENSDARG00000078429 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25204708)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24704614
GRCz11 22 24732238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGCGCCACAAAGGATACTAGCAGTGGAAGTGCTGSAGCTAGCTTTGAR[C/T]AAATGCAGAAACAGGTTAGTCTCAGCTATTTGCCCMTGAAGCAAACCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link