ENSDARG00000078427

Ensembl ID:
ENSDARG00000078427
Mouse Orthologues:
Gm10891, Gm10893, Gm10909, Gm13896, Gm13926, Gm13979, Gm16591, Gm16837, Gm16940, Gm17015, Gm6037, Gm6683
Mouse Descriptions:
predicted gene 10891 Gene [Source:MGI Symbol;Acc:MGI:3800299]
predicted gene 10893 Gene [Source:MGI Symbol;Acc:MGI:3704436]
predicted gene 10909 Gene [Source:MGI Symbol;Acc:MGI:3642826]
predicted gene 13896 Gene [Source:MGI Symbol;Acc:MGI:3702130]
predicted gene 13926 Gene [Source:MGI Symbol;Acc:MGI:3702147]
predicted gene 13979 Gene [Source:MGI Symbol;Acc:MGI:3651288]
predicted gene 17015 Gene [Source:MGI Symbol;Acc:MGI:4819748]
predicted gene 6037 Gene [Source:MGI Symbol;Acc:MGI:3649172]
predicted gene 6683 Gene [Source:MGI Symbol;Acc:MGI:3704133]
predicted gene, 16591 Gene [Source:MGI Symbol;Acc:MGI:4439369]
predicted gene, 16837 Gene [Source:MGI Symbol;Acc:MGI:4439761]
predicted gene, 16940 Gene [Source:MGI Symbol;Acc:MGI:4439864]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30824 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39878 Essential Splice Site Mutation detected in F1 DNA During 2018
sa25116 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110378 Essential Splice Site 17 113 2 2
ENSDART00000110378 Essential Splice Site 17 113 2 2
Genomic Location (Zv9):
Chromosome 2 (position 36214973)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36511683
GRCz11 2 36494140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATAATAATTCATGTTAATGATATCTACTTTTTCTGTTATACTTTCC[A/G]GTGTGCAGAGGACAAGACAGAGTGGAACAGGTTGAAGGAGAAATGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110378 Essential Splice Site 17 113 2 2
ENSDART00000110378 Essential Splice Site 17 113 2 2
Genomic Location (Zv9):
Chromosome 2 (position 36214973)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36511683
GRCz11 2 36494140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATAATAATTCATGTTAATGATATCTACTTTTTCTGTTATACTTTCC[A/G]GTGTGCAGAGGACAAGACAGAGTGGAACAGGTTGAAGGAGAAATGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110378 Nonsense 21 113 2 2
Genomic Location (Zv9):
Chromosome 2 (position 36214960)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36511670
GRCz11 2 36494127
KASP Assay ID:
554-7837.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTTAATGATATCTACTTTTTCTGTTATACTTTCCAGTGTGCAGAGGA[C/T]AAGACAGAGTGGAACAGGTTGAAGGAGAAATGAGTGACAGTGAAGGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link